GenePrediction:GLEAN_2239 Details

Name: GLEAN_2239
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1685723..1686603 (+ strand)
Length: 881
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1685723..1685802 (+ strand)
Length: 80
Type: CDS
Source: GLEAN
Position: GCSC_108:1685853..1685926 (+ strand)
Length: 74
Type: CDS
Source: GLEAN
Position: GCSC_108:1685981..1686603 (+ strand)
Length: 623
>GLEAN_2239 class=GenePrediction position=GCSC_108:1685723..1686603 (+ strand)
ATGGGCCACCACAACCGCCACTTTGCCGGCGATAGGTACGCCGGTGCTGGTGTCTGGGGAGCGCCCACAAGCACAGCCAA
GTAAGTTCTGTGCCTACCTCTCCAGCCACGTTTGCTGACCAGATCCCCAGCTTCTGCGAAGAGGATTACGCTGTCACTCT
CTACATTGCAGAGTTTATGAATACCTTGACCAACTTAGCGTACAGTGCGCTGCATCCCATCCTCCTATACCGATGAGCCT
AGCTGACCTGAGCACAAGTCTACTTTGCCATCCGCTATCCAGGTGTCTCATCGTCGAAGCAGACAGCGACAAAAGACAAG
TCCCACCCCCCGGCGCCCTCGTGGACCCGCCCGGACTTCCTCGCCGTCTCCCTCTGGATTCTTGGCACCTTTTCGCTCGT
CTTCCATGCCACCCTCAAGCATGCGACGCAATATGGCGACGAGATAGCCATGCTGGTGCTGGCCGGAGCACTGCTGCGAG
GTGTCTGGCCGCACAGTATGGCCGCTACGGTCGGCTCGGCAGCTGCAGTGGTCGCGGCATCGGCTCTCTATCTCGTTACC
GCCCAGATCCTACACCACGTGTTCGCCTTCAACAGTATGATTCTCGTGACCGGCCTTCGCACGCTCTTCCTCATTTTTTG
GCGCAGGCCCGTCGCAAACCGGCCGCGATACCTCCACCAGTTTTCCCGTGCCGTCGGCACCCTGGCCTTTGGTTACTTCC
TCTGGCAGATAGATCTTGAGATGTGTTCGAGCCTGCGTTCTGCACGCAATTTTGTCGGCATACCACTCGCCTGGCTACTT
GAATTTCATGGCTGGTGGCATATTTGTACTGCTCTCGGCGCCAGCCTTTATATCCGGCTTATCCGCGATATTGACCCTTG
A

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62