GenePrediction:GLEAN_2241 Details

Name: GLEAN_2241
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1705442..1707613 (+ strand)
Length: 2172
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1705442..1707613 (+ strand)
Length: 2172
>GLEAN_2241 class=GenePrediction position=GCSC_108:1705442..1707613 (+ strand)
ATGGACCAAACGCTCATCAAAACGAATCTGTTGCCTCGCCGGCGTTTTGCGCCGGTGCCAATCGAGACAACCTTTGAACG
CTACAGAAAAGGCGCCCCTACTGCGGTGCTAACGCCATCTCCATCTCCACGATCGCCCTCGCCGCCTCGCCGACTATGGA
CCAAGGAGAAGGAAAAGAGGCGTTTCGCCCCCCAGTTGATCGAATCTTCTCGACGTTCCCGACGAGTCGGCGATGTTGGG
CCAGCCACCAAACCTGCCGACAAGACCGATATCACGCCCTACCACAATCACATATATGCACCGAAGGCACGCAAAAATCA
TCGAAGGCTAATGTCACTCGCTCGCCGAGAGTCTTGCGATGACGAAACTGCCGACCATTTTTTTGAGACTCTTGTTCGGG
AAAACGAAAAGCGCATTCTTGAGGACGCTTTGGCTGCCTTCCCAAATAGTCGAGCCCGTGCTGGCGGCGCTGAACACTTC
GCCATTCGCGAAGCCTCTGATGATGATAGCAGTAGTTCTCAAAGCCACGGAATTACTGGCCCACGACCTTACCGTGCCGG
ACGCCGATCCCGCCGCGACTCGCTCACTGAAGACGTCGGGTGGGCCCTGAGGGAATTGCAAGAGCATCACGACCTTCTTT
TGCAAACCCGCAACGTTTCTATTGCCCATGGCAGCTCTCCCTACATTGTTCCATCTGTCAGCACAACCGAAAGCACAACC
GAAGATGTGGAAGAAACAGAAAAGGCAGATGCTGTCGCACCAGCAGATGCCGCCACGCCGGCACCTAACCGTTTAGAACG
TATCTCAACACTTGAACTCGACCGGATGCACATTGAAAGTCCTCCAAGTGATCCTATCTGGACCACAACTGCTCGCCACT
CAACCCCGGACTCTCCGCTCCATGCTATGGGTGAAACACACATGCCCTATATTCCGGAAGTGGCATTCGACTTCCCACGA
GCAACCGATGGTTATCGGGGGATTCCGGCCTATGCCCAGAGGCTCAGAGAGGCAGAGGGGGAAACCGATGAAGAAGACGA
GGACGAAATATCGCGACATATTACATCGACCCCAGGACCTATTGGCGAATCTCTCATGCCCTACGTGGCATCCGCGCCGG
AAGAGCATGTGACCGAAACCCCGACGGCATCATTAGCCATTGCGCATCTCCCACCCGAGAGTCTATTTCGTGGGCGCGGC
CCTTTTGCTGGTTATCGCAATCGTGATTTATTTGCTGAGAGGGATGTACGCAGATCGCGGCGAAAATCACCGCCCATGCT
GGGCAAGGATTTGATATTTCCCAAGTGCTTGTCTCCCAAGCAGACACAGCTGGAGCCAGAGTATCTATGGAGCACAAGCA
ATTCCAGAAATGATTCTCACCGCGACGCAACTGGAAAACATGGTTTGTGGAACGGATTTTGCTACTCGCGCGAGAAAAAC
GAAGCTCTGGCGCCGATTGAGCGCCCTGTCATGCTCGCAACACCTTTCCCACCCAGTTCTCCCGCCGACCCATTCGCTCA
CGCATTTAGTGCGAGCGAGCCCGGGACAGTCTGTGCAGAACCGGAACATGTGACTGGTAGTGGGAAACATGGGTCTAAGT
CTGAACATGATTTGTTTGCGGCGGCTTTAAATTCGCAGTCGGTCGGCACGCTGCCAGCTGGCGCTGGGACGATGACACTA
AGACTGGAACAGCATCGTTCGAAACTGCAACGCCAGGCTGACACTGAAGGACTGCATGTGCTCATGGGACTGGACGGAAG
GCTGCAGCAGGAGAAGAAAATGGCAGAGTTAGAGGAGAAAATTGCCACCGAGTTCACAGATACATTTGTCACGCAGGTTT
ACAATTATCTGTCTCTAGGTTACCCAGCCATGGCTCGAGCATATGACGATGAGCTGTCCAAAATCTCTGGCGTCCCTGTG
GCTGACCTAGAGCGCGATGATGCCAAGGCTTTGGATAATCCCGGCCACGCTAGAGGTCATATCTCCTTGGGGAATGATAG
CGGGAAGACTGGCAATGGATATATGTCGATGCGTTTGAGTCACGACGACTGCCCTCGATGGCATGCCCTCAAGCTGTACA
TTTACGAATGGGCTCGTCAGCACCCTGACCTGGATGGTATCAGTTCGTTGGCTTGGGGCATGCGTGAACGGCGTGGCAGC
TGGGGCGTCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62