GenePrediction:GLEAN_2242 Details

Name: GLEAN_2242
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1707958..1710537 (+ strand)
Length: 2580
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1707958..1707981 (+ strand)
Length: 24
Type: CDS
Source: GLEAN
Position: GCSC_108:1708417..1708473 (+ strand)
Length: 57
Type: CDS
Source: GLEAN
Position: GCSC_108:1708540..1709061 (+ strand)
Length: 522
Type: CDS
Source: GLEAN
Position: GCSC_108:1709137..1710261 (+ strand)
Length: 1125
Type: CDS
Source: GLEAN
Position: GCSC_108:1710418..1710537 (+ strand)
Length: 120
>GLEAN_2242 class=GenePrediction position=GCSC_108:1707958..1710537 (+ strand)
ATGCTCGTGTCGAGATGGGTTATCGTATGTTGTTATATCTTGCCTATCTTGCGATTATCCCAAAGTATGCCTCTTGAGCA
GAAAATTGGATTGGCTACTGTACGAGCTTCAATGGGTGCGAACTGATCACAGAGTTGGAAGCCCGTTTCGTTTTTTTCGG
CACTAACGCCAGGCCAGCCCCCTAATTAAGCCGTCCTCCTTGATTTAGCTTCCGAAGCTAAAGAGGCAACGTAATCAATT
TCTACTTTACGGAGTATCCTCCACTCATACGGTTTTTTTGTGCTGACAACTGCAACAGTGCATCCTCTTTGGACCACTCA
CCCTTTACGCATACCAGACCTCAGCAGCACATGACTTGACGACCCTTACTAGGAACCTCACTCCCAGTCCACGGCTGTGC
TCCCAACAACAGCGGTCTGTCTTGCTATCTCCATGGAACAGTCCCCTTTAACCCACCAGCCTCGCCCTGAGGTATTCAAG
CCCAAGATCGTCCAGCTGTACGACGAGCTGTTTTCTGTGAGTTCCCAACAAGCTGTCTACCAAGGACTCCCCCCGCCCGC
CCCTGGGCTAACGTTCGGACAGGATGAAGATTTTCTCGTCGCCTCTGACGGCTTTTGGACGGAGTTTTTCCTATTGCGAC
CCGACCGTAGCGCCCTGCGCCATCGAATCGAAGCATTGTCGCCGCCCCAGCTGCTAGTAGTTGAGAGTCAGACGCGGGCG
CTTTTCTCGAGAGCTATAGCGGTGGCAGCTGGGGGTGTCATTGACAAGGGGCCTGATAGGACTAGCACCGAGCGGCGGCC
TGTCCGTTCCGAGACGGCTGCCGCTGCGGCTCTTGACACACTGACTACATTCTTGTCCGCCGTCTTGGCCAAAAAGTACA
CGAACCCAAGCTCTGATGTAATTGCTGTGCTGGCAGGTCTTGACAATGTCGACACAGTGATGACCGAATTCGTGTCGGTG
CTAGATGGCTTGCTGCGACACGGACGGACGCCATCGCTGCGAGCCAAGGTGGTGGACGTCGCTCTGGCCACGGCGGCTGG
AGCTTATCAAACAACGCTTCTCACCTACTTCATCCACCGAGACCTATTCCCGTCCATTATACGGGTATGCTGCCTCGTAT
TCTCCCCTTTCCCTCTTCTTGCTGTCCAATTTGTGGGGAGATGCTGACATTCAATACAGACCATAATCGACACGGATGCC
TCAAATCAAATATTCGAATCTTTCGTACTTCTCGGCCTCCTAGCCAACTACAACAAGTTCGAATTCCGCAATCCCTATCA
ATTGCGTCTCGCCGATTTTGTAAACGAGGAAGCTATACAAACGATCCTCCACAGCGTTGGCGAGGGCTGTCAACGACTTC
GCAATCAATATGTGGTCATTCAAGATGACGCGCCAGAAGGTTGGACTCTGGCTAACACTTTGGGACTGATCGGACTGAGC
GCGATAGCACCGGGAACACACGCGCCACCCAAACCTGTGTATGACGCCGAAACGGCAAGCCGGATGTTCGCAGCCTTGCC
GGGAGATGAGGCAGCAGTTCTGCTAGCGACATATGATTTCACACACGCCAACAAGCTGTTTTGCTCCAGTTTGGTCACAT
CACTGGGGGCGAGTGTTGGTGCAAGCTCCCCCAGAAGTGCAGGCGGCGAAGCTGAGCATCCCATTGCGAGCTTTATCTCA
CTTGCGTCCTATCTTCTCCAGCACGCTTTCTGTTCACAACGCACCACCCTCTACGCACATGTGGGCCTCATGGTTTTTCG
GCTGCTGATTGAGGACGTAGCGCTGTGCAAGCGAATGTGCAGTGACGAGAGCCGTGTGTCCGTACGCCTCTGCCGCCAAC
GTCTGCCGCATCTACCGCTCGTCAAGCAACCGCGCCCTTTAGCAGCCAGTGTGATGGACGCTATGGTTGATAGCATCACA
CATAATCTGCAGAGGCGTCTCGACATTGGCCTGTACACATCGTGCGTGGGGATATTGTTGCGGCTCGTAGCGCACTTGTC
GCGAACCCGCACACGGCTAGCGTATCATTGGGCAGAGCTCTTTCGCGCACTGATCAGCCTTGTTCGCTTTCTCACAACAT
ACGCTGCCGATCTGCAGGGCTTGCCACATTTGGAGACTCTGATCGATCATGTGGTTAGTCTTATGGCGCTGGCTTTGTCG
GCGGGCGAGTCGTTTTTGCCCACCCCGGCAGCCTATGACGATTTGTTCTACAAGGTCGTCGAGGCAGGTGAGGTCCTAGT
GAAATTCCGTGACATATATAAGCTGGCGAGCCGACCGGCGAGTAGCATCGAAACGCTAGTTAGCGTGAGTACACATTATA
AGCAGATGTTGGATGATGGAGTAGTGAACAAAGGGGGGAAGGGCGGACGTGTTAAAGGTGGCGGTTCGTCGACCTCAGCC
TTGACCAGTCTGCAGGTCGCTCAAACCATAAAACAAGGCTATGAGACACTAAGCATCCAGGCCAAAGAAGGCCTTGACAG
CTGGGAGAAGTACCGTGAGGCAGATGAACGGACACTTCTGAAAAAGGTCGCACGCATTGCCGTGGCAGATGTGAAGTCTC
TTTTAGAGGGAAGAGAATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62