GenePrediction:GLEAN_2246 Details

Name: GLEAN_2246
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1718298..1719665 (+ strand)
Length: 1368
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1718298..1719665 (+ strand)
Length: 1368
>GLEAN_2246 class=GenePrediction position=GCSC_108:1718298..1719665 (+ strand)
ATGTCCCGACGGCTAGAAGATGCCACGGAAGACATTATTTTGACGGGAGGTCAAGCAGGACGACGTGCGCTTGAAGATGC
TGGGTTCAGCGAAGAGCTTAAAAGTCGACTTCTGGTCAAAATTGCTGATGCGCAAATGCGGTCGGAGCACAAGCATTCTA
CAGACAGAGGCCTGATGGGAATAGCGGCGGCGACACCATGGACTGGTGAGGAACCTGCAGCAGACACGGTGCTGCGAATG
CTCGACGACTCGCATAGGCCGTTACCGACAAAAATACGAGGCAAAGTCAACGTTTCGGGTCCTTCTTCGGACCTACGCTT
CGGGAGACTCTCGACTCAAAGTTCCAGAGAGCGGATTGCGCTAGTCCGAGATAAAGTGGCGGCCTACGCAGGACTTGAAG
GAGACGCAGATAAGGGACTTAGTGAAAGAGAACGAGAAGCTATGCGCCAGGAATTTCGGGATCGGTTTACACCGGATGCA
CGCGCTATGCCCACTAACATATCGGGCCTAGCAGCATTGGCCAACGAGCGCATAGAAAACGCAATTGCCCGCGGACAGTT
TCGAAACATCCCACGAGGTCCAGGGATAAACAGCGACAGCTGTGCTGACAAACCGTTCATTGACACAACAGAATACATAC
TGAATAAGATGATACAACGGCAGGATATAGTTCCACCGTGGATTGAAAAACAACAGGAGTTGATGCGTGCTGCAAAGATG
TTCCGGGTGCGCTTACGAAATGACTGGAGACGCCATGCAACACGATCCATTACCGAGCTGGGCGGATCACTGCAGGAACA
AATGGCCCGAGCCAATGCCTATGCACTGGCAGAGCAGGCTAACAACCCTCGGCTTCGCGACACAGAGCAGATCTCTGTCC
CTACGAACACTACTGATGACCTAGTAATGGTCAAGTTCCGAGAATTGCCGTTGCAAAAAGATGGGGCTAGAAAGGCCAAT
GAAGCAGAAACGGATGTGACTATTGATGAAGCGCAAGGGTTTCCATCTCGCGACAGCCAATGGGTGGCCATCGAGAGATC
TTATATGGAGTTGAAAGTAAAAAACCTCAACGTCCTGATCCGCTCCTACAATTTGATGGCTCCGGAACTGGCCAGGAAAC
CATACTTTTCGTTGGACCGTGAACTTCGTACATGCTTTGCCGATGTCGCTCCAAGCCTAGCTGATACTATCCGTGATCGT
GCTGCGCGACCACATGACCTTGCGTTGGCAGCTAAAAAGCAAGACACACCTGGCCGGCCTTTTCTTGACTGGTTCGTTGG
ACAGGGAAGTACCGCACGGGTGCATGAATCGACGTCCCCCAACTATGGGCTGAAGGAGATGTGGCGAGACCTTTGGAAAA
AACGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62