GenePrediction:GLEAN_2247 Details

Name: GLEAN_2247
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1721284..1722836 (+ strand)
Length: 1553
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1721284..1721794 (+ strand)
Length: 511
Type: CDS
Source: GLEAN
Position: GCSC_108:1721849..1722311 (+ strand)
Length: 463
Type: CDS
Source: GLEAN
Position: GCSC_108:1722479..1722836 (+ strand)
Length: 358
>GLEAN_2247 class=GenePrediction position=GCSC_108:1721284..1722836 (+ strand)
ATGTTTACACCAGTCGGTTTTCCGACTTCAACGATCGCAGCTGCGATTTTGACCTTGTTTCTTTCGTGTACATGTCTGCT
CTACCTTGCTAGGTTGATTGCAGGCTCATCCAGGAGATACTCATACCGATTTTCTCAAAGCGTACGACCAGTTCAGGAGA
AAGCCGGCGCGGGCAACTCGGACCAGCCGAATTATGAGGCTGTATTCCCTCCTTCTCAACGGCAGACCCTGACCGGACTA
GACACAAGATTTACCGGGATTAAGGCTATTGATCTGTCCACGCTACCAAGGAGCAGTCTCGTGAAGCTGCAAGACGATTA
CCGCAATGCAAAGCCAACACAGTTTATTTTCAGCGGATTTAAGATTCACGACATCCGTCAATTGGGTAGCTTTCCAGACT
ACGCAATTTTGTCCGGCGTCCCACCGCCGGCACCGCTGAAATCGTTCAACATCGAAAAGGCACTACCACGACCGTACCGT
CCATTCCGATGGCCGTATCATCAGACTATGTGTGAGTGAATTGTGGCCCGAAAGCGTCTCTACAGATATGCTAAGACTAT
GCCAGCTCTGACGAAACTGGATCCGGATTTTTGGATTGAGCTAGAAAGTTCGTACCGTGAACGGATAGCACAACGGGAGA
AGCTTTTTGCGGAACATGGAAGCAACGTTCTTGCCGCTTTGCCGGGCTCAGAGCTGGCCTGCATCGAGCTCATGGAGATG
GTCTTACAGTTTATATGTACACGGTACCCTAATGAGTTTCGAGTGGAAAACGGGGTTCTAGTGAACAACATTCTGAAGAC
TCGAACGCACCTGTCAACTACGCCAGCCCTGGAAGTGCTTTTGCACAATGTGCCTGAAGATTTCGCTATTGTGTTGCGTG
ATGAGGAGACAGGGCGTTACGTTCTTCGTGCAGGGATGGTGTGCTCTTCCGTGGGCTGGAAACTCAGTGAAAAGGTTGGT
CTGGGGCTGCCAGGAATACACAAGTATGTCCCGGACTACAAAGAGAAAATGGAGTTCAGTATGGATCGGTACGTGAGAGT
TTCGGCTGTTTTTGCAGTTGGATCTTGAAGCCTAATTTCGTTTCTAGTTTCTTTACTAAGATGCCGACAAACAAACCCAT
TCAAAGAGGGTCTTGGGGACTAGAAGTCGGCCAGCCCCTTTTTTTGCCCTCGGAACATCCAGATTTTGCACATAGAGAGT
CTCAAAACCCGAAGCTACAACCTAAAGACATCAACCTCCGTGTTGACTGGCAAACTCTACGGCGACTGCCTCTTTCTGGC
GGTGTGGTATTTAACTTCAAGGCACTCTTCACACCCTTGTCTGAGCTCGAAAATGAGCCTTACGTCCCATCTCTTTTACT
CACCGTTCTTCGTGGCGGAAAAGAAAACTTGATGAGGTACAAAGGTACATGGCACGTGGAACACATTGCAAAGCCGACGC
TGGAAAAATACAAGCAGTTTCAGATCAGCAGTGGGATGATAGAGGATAACTGGGAGCCGCAGTCGCTCCCCGAGCAGCCC
TTTTTCAGGGGCTGGGAAAAGAAGTGGGCCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62