GenePrediction:GLEAN_2248 Details

Name: GLEAN_2248
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1733642..1734719 (+ strand)
Length: 1078
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1733642..1733677 (+ strand)
Length: 36
Type: CDS
Source: GLEAN
Position: GCSC_108:1733746..1734180 (+ strand)
Length: 435
Type: CDS
Source: GLEAN
Position: GCSC_108:1734279..1734643 (+ strand)
Length: 365
Type: CDS
Source: GLEAN
Position: GCSC_108:1734698..1734719 (+ strand)
Length: 22
>GLEAN_2248 class=GenePrediction position=GCSC_108:1733642..1734719 (+ strand)
ATGGCAGCGAAATATACTTTGGCGACGAAGGTCAAGGTGAATGAAAAAAATTGCGAAGGAACTGACTCCGAGGATGTAAG
CTAAGGTTCCTTTTACACCTATAGCTGCGGGATGGCAAGGAGATGCCTCAGATCCAATTAGGACTGTACATGATGTCAAC
GAAGGAGGCAGCGCAGTCTGTAAAAGCCGCCTTAGCCTCTGGTTACCGTGGATTTGACTGTGCGCAGATGTACCACAATG
AACAACAAGCTGGCAAGGCTATTCGGAGCTTTCTACAGAGCCCAGAAGGCGCCCATCTTGACCGCAAGGATGTATTTTAT
ACATCAAAGCTGGCACAAAACAGCGCAGAATACGAAGCTGTGCGACGCTCAATTACCGAGTCTGTAACTGTGTGCGGACT
TGGGTATATCGATCTGTTTCTGTTGCACAGTCCATATGGGGGTACAGAAGCTCGCCAAACGAGTTGGCAAGCTGTGGAGG
ATGCCATCGATGCTGGCGAGGTCCGATCGGGTGGTGTGAGCAATTATGGCACGAAGCATGTGCGTATACTGAAAATCGAC
CTTAGAACCAACCTTTCGCTAATTTTGGATGAATTTGCCACCTTTTTAACCCGGCGCTAACACAATTTCTTCTTTAGATC
GATGAACTTACGGCTGTAGCGCGCATCCCACCCGTTGTTAACCAGATCGAAGTTCATCCGTTCAACACACGCGCAGATAT
TCGCAATGCCTGCGCCAAACACGACATAATTATCGAGGCGTATGCGCCGCTTGTACGCGGCATGCGCATGAGCCATCCTA
CGATACAAAAGCTGGCTAAGCGCCATGGCTGCACACCGGCGCAACTCTTAGTTCGTTGGTCACTGCAGCACGGACTAGTA
CCCTTGCCCAAGAGTATAAACAAACGACGTATGACTGAAAATGCGAATGTGAATGGCTTCGTTCTCTCGGACCAGGAGAT
GAAGATGCTGAATGACCTAGACGAGTACCTTGTAACAGACTGGTGAGTTCAACTCTTGTTAATCTAAACTGAATTGTTTC
TTATTCTTATTATTAGGGATCCAACCACCACGCGCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62