GenePrediction:GLEAN_2249 Details

Name: GLEAN_2249
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1758433..1759241 (+ strand)
Length: 809
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1758433..1758471 (+ strand)
Length: 39
Type: CDS
Source: GLEAN
Position: GCSC_108:1758528..1759241 (+ strand)
Length: 714
>GLEAN_2249 class=GenePrediction position=GCSC_108:1758433..1759241 (+ strand)
ATGAAATTCTACGCCCTTTTGGTACAAGACCCTCTGTCAGTAAGAGGACCTCTACGACAAGTGTGCTTGACCGCAAGCTC
TGGAAACCTTTCAAGCTTGTCCGCAAGACGCAAGTGGCCCCAAAAGTGTACCGGATTATTTTTGCTTTGCCCCGTTCCAA
CGACCCTCTTGGCCTGCCAACAGGCCAGCACATAGCACTCCAGGCAAAGATCAACGGGGAAAGCATTGCACGATCTTACA
CACCAGTGTCCAATAACAACGATCTGGGCCGCATTGAGCTGCTGGTGAAAGTCTACGAAGGCGGTCTGATGACGGAGCAC
CTTGAAAAAATGCAGATCGGTGACACCATCGATATTCGTGGCCCCAAGGGCACAATGGAGTACAACCAATCATACGCGCG
GCATATTGGCATGATCGCTGGTGGCACTGGCATTGCACCCATGTACCAGCTGGTGCGCGCAATTTGCGAGGACACGTCAG
ACAAGACAAAGGTCAGCCTCATTTATGCCAACAATTCAGAGAGTGACATCCTCCTCTTTGAAGAACTTGAAGGCTTTGTG
AAACAGTGTCCCGGCAAGTTTGACGTCCACTACGTGTTGACAAAGCCACCGGTAGACTGGAAGGGCAGCAAGGGATATGT
GACGGCAAGCATGATTAGCAAGCATTTGCCGGCGCCTGCTGCAGATACGAAGATCCTACTTTGCGGTCCACCAATGATGG
TTAACGCCATGAAGGCACACCTAGCGGAGATAGGGTTTGAGAAACCAAGCGTTATATCGAAAGCAACAGACCAGGTTTTT
TTGTTTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62