GenePrediction:GLEAN_2250 Details

Name: GLEAN_2250
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:21344..22630 (+ strand)
Length: 1287
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:21344..22100 (+ strand)
Length: 757
Type: CDS
Source: GLEAN
Position: GCSC_140:22209..22630 (+ strand)
Length: 422
>GLEAN_2250 class=GenePrediction position=GCSC_140:21344..22630 (+ strand)
ATGGCACTGCCTTATGTTCTGCCTAATGCGGACAACTTCTTAGGCGTGGCCCTCGTCGTGAACAGAAACCGCGAAGGGCC
GCGATTTGTTTTTCACTATCCTAGTCGCATCTACTCTCGGAGAGAGTCTTGTGCTAAACAGCCGAAAGATGAGGATGCTT
TTGTCGATGGGGCATTGGTACCTACCAAAAAGAGCGATATCGACTATGCCCCCAACTCCGAAGAGCTAGCCCGATGGAAC
CACGATGACCATCTTGCAACGAACAGCGGAACGCAGTATGTCCCTTGGGAGTACGTTGCTGGTGCTCCAACCAAGGCCCT
GGAAGGAATTTTGACACCACCACACGCTTTTCATAAGAAGCGTTTTCAAATTTTGCTCGATTCCGTCTACTATTTATCTT
ATCCCATCCATGTGCCGGAAAGCGGTTTCTGGGACAGAGAAAAGAATAGAAAGGGACGGGTTCGTAAGACGAAAGAAGCT
TCCACATGGGCCGGAAGCGCCAAATTTGAAGATCGCCCTTCGCGTGATGGCAATAATGCTGAATGGAAGGAAGACAAAGT
CAGCTCCATGACTATGTTCAATCTTGTTTTCGTTTTGAACCCCAAGCGGCATGAAGCAAATGAGCTCCTTGACGTCATGT
ACACCCACGTTGTGCGGGAGGTGAACAGAGTATACAAATACTGCCAGGAAAGTGGTGACTTTGTATGGCAGGAGTGCAAG
AAAGTCATTCAGCTCAAGGATAGAGCCAAAGAAGACCGTGAGTTATACACCTGCTTCGAATCCACAGATGTGGTCCTGAA
GTATTGATTACACCCGGTTCGAACGGACTATGCTTCTGTTCGGCACTGACCAGCCTATGAAATAGGAACGAAGATGAGCG
TGCTGTGGGAGCAAATACTGACGGCATCTTCCCTGGCGGCGTCGATAAGAGACATATACGAGGCCGTATGTCGTAACAAG
ATAGCAGTTCTCGAGCTGAGTCTCGGAAGGGGTTCCGTTGGACATTCCGTGCAAATACCCATGCCATTTTATGTAGCAGA
TGTGCAGCCACCAGGAAACGAGGCTGCCCGGAGTCTCTGGCTAACGACAGCCAATTCGGTCTCTGGCTATGATATGCTTG
GTGGTTTAGCTGCTTTTGACAAGTGCACTGCGCTTCTACTTACCGACGATGACGACAAGAAGATCATTGCAGAGCTCCAA
GCTCGCAGGGATAAGGCAGCCACGGCTATGATCGAGCTTGTCAAAGCTGCGAAGCCCACGCTCTCGTATGCAAACCCTGT
CCCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62