GenePrediction:GLEAN_2252 Details

Name: GLEAN_2252
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:31405..34813 (+ strand)
Length: 3409
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:31405..32784 (+ strand)
Length: 1380
Type: CDS
Source: GLEAN
Position: GCSC_140:32854..34124 (+ strand)
Length: 1271
Type: CDS
Source: GLEAN
Position: GCSC_140:34209..34229 (+ strand)
Length: 21
Type: CDS
Source: GLEAN
Position: GCSC_140:34360..34813 (+ strand)
Length: 454
>GLEAN_2252 class=GenePrediction position=GCSC_140:31405..34813 (+ strand)
ATGTCTGCTACAGGTTTCTCTTATGCTCAGGCCGCTCGCGGCCAGGCAGCACCGCAAGTAACTACGCCTGTTACCAGCTC
AGTAGCTCCTCCACGGGCGAGCCCAGAGGAAAACGATGTTTCGAATCCCACAACAATCCCCGAGGCAGGTACTGCCTTGG
TGCTATCTGTCACGAGCGATGCGAGCAAACTAGCATCGTCTGAATCAGGATACGGTTCACGAAAGGTCGATTCAGATGCG
GGCTCCGCAACTGATTCTGCTACGTTGATTGGCACGCTTGTCGAATCGACATCCAACATTTCACTGGACGACGTATCTTT
TCATGCCAGTGCAAGCTACAAGAACGGCTATGCCTCAGCTATTGCTACACGGTCTTCCTCGTCTGATGATAGCGCCAGAA
AGAGCCGGAAAGGCAAAACAACAAAAACATCTACTAAGGACGCAGATCTACTTTCTGTGGACGATGCAGAGAAAGACGCG
GAGGCTCCGAAGGTGGTCTTGTCTCCAGCGCCCGTGCCTATCAAGAATATATGGGATGAGAGGCGGCGTGAGCTTGCTGC
CAAGGCGAAGCAACCCCCCGCTAGCAAGCCAGACTCGTTGGTAGTGGCCACGGGTGCTACGGGTGCAAATGGTGGGCTTG
TGAAGTCGCAGGAACTGAAGAAAGGCAGTGCTCCGCCGACTGATCTTGAAAATCATTCGGAGACATTTGGCGCGACAGCC
ACGTTCAAACCCCACCAAAGAAGACTGAGCGAGACTTCACGTGGCGACCAAACGCGCCGCAACGGTTCCCGAGTGAGCAA
GGTGGTAGATAAGGATGCTAAGAACCTTTCGGGGCGCAGCATTTTGCCGTTTGTCCAAGATACAACTCTTTGGCCGACCC
CTGAATCTGCCGCTGTGACTGAAGATGCAAAGGCGAAGAGCCTTGCAGAGAAGGTGGACAGATTAGATGATGGTGACAAG
GACACCCAGGAGGAAGGGGCTCTTGCGAAGTCCCGGAAGAAGGGAGCTTGGGTTGCGCTGGATTTTGTCCCTACTGTGAA
TTTTCAGACCCCTCTCCCTAATGTCCGCGGCTCGAAGCCAAAGGCAGGATCTCGCGGCGGCCGCGATTCTTCTTCTAGAG
GGGGCTACAACAGCATCGCGAACGGCTCCGCTCCGTCGGAGAAAGCGGTTTCCATGCCCACGCCAATGGACAAGACTCCA
GACTTCCGAGACAAGGCAAAAGAAGCCAATGGTACAGCGATCACGGCGAGACCCCACTTTCACGCATCCAACCCTGCCAA
GCGCTTCTCGATAGACTCTACCCATAACCGGGAGATACGAAAGTCATCTGCAGCTGCCGATCACGACAGGACAAAAAATG
CTGTGTCTAACTATTCAGGGGTATGATATTTCAGCCTCTCTCCTCATCGCTTTGACCAATCAAGCTAACAGGCCTGCTTC
CCTTATCAGCTCCCAGTTAGAGCCGATTTTGTTCCTAAAGGTACCTACGGAGGAGGAGTGAATGGCGACACTGACAATCA
CCACCACATAGCCCTTCCTGTCCAGTCCGATAGGCGATTTGCGACAGCCAAAGCCACCGACCATCATGCGTCTTCTTCAA
AGGAGAACGGGACTTTGCAGTTGAAGGAACCAGGTTTGACTGCACGGGAACGGACAGAAGCTAGAGGTGAACGCACTGGC
CGCGGTGGGTTCCGTGGTGGCCGTGGCGGCCATGCAAGCAGCGCTTCTCAAGGCCATCATTTTTCTCGCTCGGGGTATCA
GCAAAATGGGCAAAGAGCTGCATCAAACGGGGCAGTATACGGCAGCAATGGCTCTTTGCCACCGTCCGCTGTACCATTTA
ACCCGACGGCACAGCAGTATTCCTTTGGACACGCAAGCAACGTGTCGCGGTCTAGCAAAACTCCTGGGCGAGCGCAGTCT
GTATCGCAAGTCCCGACCTTTTCTAATCGCTTGCAAAATGGGGTGGCAAGCATCGCTCGGTCCCATAATCATGCGGCGCA
GATGGCCGGGGTACCTGCTGAGTTCCATATGCAACAACCCTACCCATTCGCGACATATTCGAGCATGGAAATCGAGCACC
TGCAGCCCCTGGTTAAGCAACTGGAATACTACTTTTCGTTGGAAAATCTTTGCAAAGACATGTTCCTTCGCAGGAAAATG
GACGGCCAGGGCTTTGTTCGGTTGGCAATCGTTGCGAGCTTCAGACGGATGGCGGAACTAGCGCCAACTCTGGACTACGT
ACGTGCTGCATGTGAACAGTCTGAGAAGCTCGACTACATCCTTGACAAAGACCAGACTGAGCTGGTAAGGTCACGCACAG
AGTGGAGAAAGTTCATCTTGCCGGAAGAGCAGAGAATGGAGGAGGTGCGCGGCCCCGGCCCGGACTTGAGGAGTGTCCAT
TTTCGCTCGCTTCATAGCAGGCCTCCGCCGCCTTTTTATCCCGCCGCCCTTGTAGCTGGTTATCCGACTACAAACCCGGC
GATTTTTCAAGCGTCAGCATTCGCCCCTAATGGAAGCGAACCGATGTACCAGCCATACGACAATGGGATGTCTGTGGAGC
ACACACTCACGTCCAATGGCAACACTCAAGTGAACGGAGGGCCGCCTTCAGGTGAGAGCCAGCTGTCTGCTAAGGTTCCA
GTGTTCTCCCCATCGGGCGGCAGCGGTGCACCGACGACGTTGGAGGACTATCAGAACTGTCCAGATGAGCAAGTCGAAAA
GTTAGTCGTGATTGTGGCTCCAGACACGGATGTGACCTCAACCACTGTCTCAGAGATAAGTTTGGGACCGAATGGCTCAC
ATAGTTCCCAGGACAACATGTTGAGGTATGTTTGGCAAGCTTAAGTGTGTTTTTTTCACCTTTCTGGTCCTATATCTTGC
CTCCTTATTGTCCTTCTTTTCTATTTTGAAACACCGCCGTTTATCTCCTTACTCTAACCTGGGTACGACTTCAAGCAACG
GTCACGACTATTCTCTCGAGACGTCTCTGGAAACACTTATTGAAGGCTCCAGGTCTGCTACTGTTATATCGTCAGCACCT
CTCTCTCTCCCTGCCACAGATGCAGTTGGAGGGGAGCCTTACCCGGGTTTGCGGACGAAGGCCTTTGATCAACGGAAGAA
TTCTAAGTCCGGCGAGACACCAGCTGCTATGAAGCATCTTTACCAATTTTGGTCCCATTGTCTGCCTGACAAATTCAACG
TTAGGATGTATGAGGATTTCCGATCATCCGCACTAGAAGATGCCCGTGGCGATATGCCATGCGATTTCGGGTTGCGGTGT
CTTCTTCGGTATTACAACCATGTTTTGACCGACGCAGGTCCGAAACCGTACCCGTCGGTCTTTGTGCCGCACTTCACTGA
AGCCAGGGAACTCGTGGGATCGTGGAAAGCGGCCAGTGGTGAGGCCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62