GenePrediction:GLEAN_2255 Details

Name: GLEAN_2255
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:48991..50010 (+ strand)
Length: 1020
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:48991..49083 (+ strand)
Length: 93
Type: CDS
Source: GLEAN
Position: GCSC_140:49245..49454 (+ strand)
Length: 210
Type: CDS
Source: GLEAN
Position: GCSC_140:49510..49531 (+ strand)
Length: 22
Type: CDS
Source: GLEAN
Position: GCSC_140:49604..50010 (+ strand)
Length: 407
>GLEAN_2255 class=GenePrediction position=GCSC_140:48991..50010 (+ strand)
ATGGCTGCAGCCGTGTATCCGGAGCCGGAATGCAGGAGTAAGCGCGGCTTTCTGGGCCCCGACAACTCTGCGCTCTCCTT
GCAGGATCGCCATGTAAGTCAGGATACCCGCTCATTCCCTGTGTCTGACTCCCATTGACTTCCTGGAACCTGCGCATCTG
GGGTGTCGCTGCGTCTGGCTTCCTCACCGACTCGTACAACCTCTTTGCCACCAACGTCATTCTCGCATCCATCTCCTTTG
TCTACTTCCCCGAGGCAAAGTACCGCCATGTCGGCACCCTCATCAACGTCTTCACCCTTCTCGGCTCCGTTGTCGGCCAG
CTCTGCTTTGGCTTCCTCGCCGACTACTACGGCCGGACCCGCCTCTACGGCATCGAGCTGGTCCTCGTGATCGTCTCCAC
CATCGGCGTCGCTACCAGCAACTATGGGTACAAGGACTTGTCCTTTCTGGGCTTGTTCATCTGGGTGAGTGCTCTCGTAT
TCTCCCGTTGTCCCCTCGGCCTCGACTGATCCGTCTCAGTGGCGCTTTGTTATGGGAATAGGTAGCAGCTTCCTGCCCAG
CTTCTTACGAGGCACAACACCCCCAAACACACACGCCCGCTGACAAAATCCAGGCATCGGTGCGGAGTATCCGCTGAGTG
CGGTCATAACCGCCGAGTGGGCCAGCACCTCTTCCCGTGCTACCATGCTGTCGTCGGTCTTCCTGATGCAGCCGGTCGGC
CAGGCATTGGCCCAGCCGGTCGGCCTGTGGGTGGTCCTAGGTCGCGAGGACTTGTACCACCTTCAGGCCATGCAGTGCGG
CATCAACACCAAGAACGAGGACAGGTGCCGTCAAGCCATCGATGGCATCTGGCGTATCGTCATCGGCTCTGGTGCCGTGC
CCGCCCTGCTCGGCACCGCGACCACATGGTTTCTTCTCGATGTCAGCTTCTATGGCTCTTCGCTCGACAATAGCGGCGTG
CTTGCCGACTTGTGGGCCACCCGCAGCCCACCGGCCCTCGATAGCTCGCTCTTCTGCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62