GenePrediction:GLEAN_2257 Details

Name: GLEAN_2257
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:54760..56068 (+ strand)
Length: 1309
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:54760..54917 (+ strand)
Length: 158
Type: CDS
Source: GLEAN
Position: GCSC_140:54981..55054 (+ strand)
Length: 74
Type: CDS
Source: GLEAN
Position: GCSC_140:55108..55346 (+ strand)
Length: 239
Type: CDS
Source: GLEAN
Position: GCSC_140:55405..55807 (+ strand)
Length: 403
Type: CDS
Source: GLEAN
Position: GCSC_140:55857..56068 (+ strand)
Length: 212
>GLEAN_2257 class=GenePrediction position=GCSC_140:54760..56068 (+ strand)
ATGGCTCCAACCTTCTTGCGCCAGCGCGAGAAATTGCCACGGGAGCGATTTGTGAGCTACTTTTCGGGCCTGAAGACACA
GGCATACTACGATCCTGCCGCTGCCAGAGCGCTGTCCTACCACGACCCGGCTGCAACAGAGAAGGGCGAGATCATCGGGT
ACGCCCTCCAGACAGGCTGGCGCGATCGCGAAAAGTCGCGGTGATGACTGACGCGCCGCAGAGTGCGATCCATCTCCTGG
AACCCGCTGAGCACACTGGTTGCTACGGGCTCGAGTGACAAGAGCATCCGCGTGTGTGAGTTGCAAACTGCACTTCCGTG
GAGCTGGATGTCCGGCTGACTCCAGCAGGGAACCCCGAGAAACCGAATGTGCAGCATTCAACACAGCTAAAGGGTCACAC
GGCACCGGTGGAGAAGGTGGCCTTCAATCCTGTTCGCGATGCTGAGCTGTGTAGCGTCAGTGCCGACGGCGTGGTCAAGT
TCTGGGATGTGCGCACAAAGGCGTGTGTCAACGAGGTTCGCAACCTGGGCGACACGTTCACGCTGGCCTGGGCGCCGGAC
GGGGACAGCCTTGTCGTCGGAAACAGGGTGAGTGCACCGGCAAAGACGTGTCTTGAGAGAGACGGGTGCAGGCTGACACC
GGCAGGAAAACGACCTGCACGTTTTGTCGCCGACACAGCCGACACCACTGATCACGAAGCGGCAACCGGCGAGGACAAAC
GACCTTGCATTCTGCTGGGGTGGGAAGAAGCTGTTTGCCGCCTCTAGCGACGGCCGCACGAGGATACTGTCGTTCCCCGA
CCTGGAGCCGTGTTTCCGCGGCAATTTCACCGCGGCCACTTCTGCCACCGACGACGACGACGACGACACATCTGCTGTCG
AGTTTGCGCTCCGAGGCCACACGGCCGAGTGTCTGACCGTGGCTATGAGTCCGACGGGGCGCCACCTGGCTACCGGCGGC
TCGGACGCTATCATTGCGCTGTGGGATACGGCAAAGTGGACGTGCCAGCGGACGATCACCAAGATGCTCGGCCCGGTTTG
CAGCCTGAGTAAGTCATGCCAACGGGTGTGTGAGACTGCGGTGCTGACAATCTGCAGGCTTCAGCTGGGACGGAAACTAT
GTGGTGGGCGGAAGCAGTGAGGGCACAGGCCTGGAGGTCACCCGGCCTGAAAGCGGCGATCACATCTACACCTTCAAGAC
AGCACAGCCGGTGCCCGTAGTGTCATGGGCACCGACACGGTATTTCCTGGCGTACAGCGAGCTCGGAAGTCTGCGCATCG
TCGGCGTCGACACGGAGAGAAGGGCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62