GenePrediction:GLEAN_2258 Details

Name: GLEAN_2258
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:57203..60336 (+ strand)
Length: 3134
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:57203..57476 (+ strand)
Length: 274
Type: CDS
Source: GLEAN
Position: GCSC_140:57536..57917 (+ strand)
Length: 382
Type: CDS
Source: GLEAN
Position: GCSC_140:57984..58061 (+ strand)
Length: 78
Type: CDS
Source: GLEAN
Position: GCSC_140:58129..58398 (+ strand)
Length: 270
Type: CDS
Source: GLEAN
Position: GCSC_140:58458..59092 (+ strand)
Length: 635
Type: CDS
Source: GLEAN
Position: GCSC_140:59215..59420 (+ strand)
Length: 206
Type: CDS
Source: GLEAN
Position: GCSC_140:59485..60336 (+ strand)
Length: 852
>GLEAN_2258 class=GenePrediction position=GCSC_140:57203..60336 (+ strand)
ATGTCTCCGCCCGTGTCGCCTGATGGCACCAACCCTGCCGATGTGTTTGGCGACTCGATGACGGCCGCCCATATGGACGA
CAACCCCAATGCTGGCATCCCCCGCCAGAAGCGTCTCGCCTGCCTCATCTGTCGGCGACGCAAGCTCAAATGCGATGGCC
GGAGGCCCAGCTGCAGCACGTGTTCCCGCCTCGGCCACCCCTGTTCATATGACGAGGTGCGCAAGAAGAGCGGACCAAAG
AGAGGCTATGTCAAGGCTCTCGAGGAGCGGCTCAGTATGTGTTTTCTCAAGCATCGACCCCAGCACGACTGCTGCTGACA
ATGCGCATTACAGAACAGGTCGAGGTGATGCTCAAGTCGCAGGACAACATGGCTGTCTCCGGCAGCGCTACGGCTGCAGA
CGCCCTCAAAGGATATGCTGTTGACGGCGGTCCTGGCGGCTCTGTGAATGCTGCTTTACCCGCCGAGCGAACCCCATCCG
CCGGCGACTTCCACGTTGCCGACCCGTCTATGGGCCTGTCCGGTGGGCGCGACATGGAGCGGTGGCAGTTCAACGGCGAG
TCACCACCACCGCGTCAGGGCTCCTTGGACGAGTTCAACTTTGGCAGTCGCATCCCTATGAACGACATACATCCCGTCGA
TGGCAATTTCACCTGGGAGATCATCAATCTTGGCCTGGACGAGCCTCTACCACCACAGGAGACTATTGACGAGCTGTAAG
TTTTTGTCCCTCGGCGCTCTCCGCTCGATCTAGAAGCTGCTAATGACGTCTTTCCCCGCAGACATCAAGTGTATTTCGAC
AAGATCCACCCATCGTTGCCCATGATCCATAAGTACCGTTACCTCGCCGCCATGAATCTGTAAGACGACGCCTTGCGTGC
GATACAGCTCACAAAAGCTGCTCCTGGAGCTGACCTTTCTTGCCAGTGCTCCGAACCAGCGACCGCCGGTGTGTCTTCGG
TACGCCATGTGGATGCTTGCCTGCTCTGTCACAGACAAGTACAACGATCTCAAAGACCTCTTCTACCAGCGGGCCCGCAA
GTACCTGGAGGCCGACTACGTCAAGGGCTACGGAGAACATATGATCTCCGTCGCCCACTGCCAAACGCACATTGTCCTGG
CCTCGTACGAGTTCAAGATGATGTATTTCCCTCGCGCATGGCAAAGCACTGGCCAGGCTGTTCGCCTTGCCCAGATGTGC
GTCATCTTCCTATTCTCGGTGCTGTTTTGCCTCTGCTGACAAGGCTGCAAACCAGGATTGGGTTGCATCGTCTGGACGGC
TCCGGCCTCGATGTCAAGCAGTGCCTGCCGCCCCCGCGCGACTGGACCGAAAAAGAGGAGCGCCGCCGGACTTTCTGGAT
GGCCTACTGCGAGGACCGCTACGCAAGTATCGGCACCGGCTGGCCCATGATTGTCGACGAGCGCGATATCACCACCTTGC
TGCCTACTTCGGAGGAGGCATTCGACATGAGCCGGCCCGAGCCCGGCGTCTCGTTGCAGGATGCCATGTGCCCCTCGGGC
ATCGGCCAGCTTACATCCTTTGCTGGCATTGTCCTGATGGCCTGTCTGTTTGGCCGCAATCTCACCCATTTTCATCGTCC
GGATGCCGACGAGCGGGATGACGACTTGAACGGCGAGTTCTGGAAGCGCCATCGCAACCTCGACAACATCTTGCTCAACA
CCTTGTTGGGCCTTCCTGCGCATCTCAAACTGCCAACCGGTCTTCAGAACCCCAACATTGTATTCACCAACATGTCCATC
CACACCTCCACCATCTGTCTGCACCAGGCAGCCATTTTCAAGGCAGAGAAGAACGGCCTGGCCTCCTCTGTGAGCCCGGA
AAGCAAGATTCGCTGCATCAACGCTGCCAATGAGATTGCTAGTATCATGCGTATGGTATCGCACATGGATCTCTCTTCAG
TATGGCCCTACTGCGTGCTATTGCTCCGCATTTGACCGTCTGCTAACAAAGCCAGATGAATCCGTTTGTATCATTCTGTC
TCTATGTGGCAGCCCGGGTGTTTGTGCAGTTTCTGAAGACGCGTCCCGACCAGAGCACGACGGTTGACTCTCTGCGCTTC
TTGCTCACGGCCATGGGTGCTTTGAAGCGGAAGAACCCACTGACCGAGTCGTTTTTGGTGCAATTGGACGTTGACCTAGA
AGCCCTGGCCGACCGCATCCCTGAGCTGAGGACGGCCTTCCCGTCGAGCAACGATAGCGTGCGTCCCGTTTCTTGCCTCC
CTTCCTTCCCCTGGTGTCTTCCCGCTGACCTGGTGCTAATAGCGTAAGCAGCCTGCGTCTGGTTGCAATGTATTGGGACG
TCAGGGAGCATCATGTGACGAGGGGCCAGGCGACGGCATTCTTTCGTACCAGAAAGAGATTTCCAAGTCTATAACGGAGG
TGAACGCAAACACATCGAACAGCGGCACCGGCGACATGAGCGAGGATACGGGCACCAGAGACCGGAACTCGGGATCGAGC
TCCACAAGCACAAGCGCGAATGGAGGTGGCAACGGAGCGGGACCACACGGCTGGCTCAAGCCAGAGCCGCGGCTGCCAAC
ATGCGATCGCAGCAGCAACGGGCACTCTCCCATGTTCCAGATGGCTCCCGGCACGTATCCGGACCAGGCCGGTCAGGCAA
TTTCCATGCAGGGCTATGCCCAAGGCGACACCGGCACGGATAGTCACGAGCTGTCATCCACATCGCCCAGCGACATGCTG
TCAAATCGGCCGACGCCCAATTCCAGCGTGGGTTCGGAGCAGAGACAGACGCTGGCACCACTGCCTCAGCCAGGGCCTAG
CCACATGCACTCGGCTGCAGGCCCATACGACGCCAGCCCGGTGTCGCCGGCGCACGGTATAGGAGGAAAATCGGTCAGGG
CAGGCAGGATCACTTCCAGTTTCTATGCGGCGGCAAGCGGAATCCCGTCAGAGTACGGGTCGCAGCCATCACTGTCGTCC
GCGGGCCTAGACGGGATGATGTCCGGACCATCATCTGGCGAGTACACATTGTCGGCCGGGTGGAGCTTACCGGCACAGAC
AGCCATGACGCCTGTATCAGAAGGCGTATTGCATACGATCATGCAGATGGGACCGATGGAGACGATGGACCTTGGATGGG
ATGCGAATCCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62