GenePrediction:GLEAN_2259 Details

Name: GLEAN_2259
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:64754..66284 (+ strand)
Length: 1531
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:64754..64810 (+ strand)
Length: 57
Type: CDS
Source: GLEAN
Position: GCSC_140:65206..65304 (+ strand)
Length: 99
Type: CDS
Source: GLEAN
Position: GCSC_140:65366..65468 (+ strand)
Length: 103
Type: CDS
Source: GLEAN
Position: GCSC_140:65586..65605 (+ strand)
Length: 20
Type: CDS
Source: GLEAN
Position: GCSC_140:65689..65776 (+ strand)
Length: 88
Type: CDS
Source: GLEAN
Position: GCSC_140:65854..66284 (+ strand)
Length: 431
>GLEAN_2259 class=GenePrediction position=GCSC_140:64754..66284 (+ strand)
ATGACGGCACCACCTGCGAACGTGGGGTCTGGCTGCAGATCGCTGGCCAATGATGAGGTCTGTGCCCACGGCCCGGCGCT
TAACTGAGGCAGTATCTCTACATAGAACTGTATGTATCGTCGGGTCGGCGGCACGCCGGCGCGCTCCATCCAATGGCATG
GGGTCTGAAAGAAGGACCACGATCTGTGCATTGGGCAGGCGTTGAAGAAGTACCGCCGGTTTGGCAATCGAAGAGAAAGA
CGAGATGAGCCACAAAAGCGACAGCCAACACTATTAGGGAGCCATGGGCGTACTTCAGGTGCTGTGGCATTGCCTGCAGG
GTTCAAAGTACAGCGGAGTGCCCCTAAAGTCCGCTGCAGATTGCTACCCCGCCAAGCTAAACAGAAGGCGCGCGATCAAA
CTACGGGAAAGAGGGGCAGCAGCCGCGGAAAAAAACCACCACGACATCGGAGCTATCCCAAAGTGAAGGCTCTCACCACA
ACCGCGTCAAGGCAGAGCCGAACTGCATCATCCACGCGTACCCGACGACCTCGCACGACGACGCGCCCAGCGTACTGCCA
CGCCCCCTTCAGCAACGCATGTGACAACGGAATTGACGGTCTCCCCTTCCAGCGACAGATAACAGCCCAGCAGCCGATCT
TGGCCAGCATGGCCGACGTGGAAGCTTCTTCCGAGGCCGTGGAGCCCCAGAGTCGCCACATTGTCTACTGCGGCGGTACG
CCATTGTCCCCCGGGAGGTCCCATCCACCTGCCTTCATCCGCATCTCGCGTAGAGAGCTTAGGAGCTGACATGACCTGTG
CCTGTTGTTCTGCGCCCATTGTCCAATTACAGTGTGCACATTGCCACCCGAGGTAAGACATGCCATCACCCCAGCTGGCA
CATGGGACCATGCTTGCCCGTTCTCTCCGCGGTGCTAACAGCTAACCACACACAGTACTGCGAGTATGGAGGAACCGCCA
AAAAGTGCCAGGAGTGGCTAGAGAAGAACCACCCAGACTTATACCAGAGGATCTGGTCACCAGGTTTGTGGCGCGCGCTT
TCCCTTGGCATCTTGCAGTGTGCCGCCCTGCTGACCGGCACGCTTTTACCCTCCTTGCAGAAGCTCTCGTGGCTGCCACC
GCCGCGCTGTCAGTCGAGGCCCAGAAGCGCGCCGCCAAGGATGCCCTCAAGAAAACGGCCAAGGCCGAGGCTGCCGAGCA
GAAGCACGCCACCTTGCTAGCTAAGAGCATCGTCACCGTCAAGCGTATTGAGCGCAACAAGCGCAAGTTTGTCACATCCG
TCTCCGGCTTGGAGGCCTTTGGCCTGGAGCTGAAGAAGGTGGCCAAAGAGTTTGGTAAGAAGTTCGCCACCGGCTCCTCT
GTTACGAAGACGCCAAGCGGAGGCGAGGAGATCGTGGTCCAGGGCGATGTCAGCGACGAGATTAAAGACTTTTTGCTGGA
GAAGTACAAGGACATTGCGAAAACCAACATAGAGCTGGTGGACGACAAGGCGAAGAAGAAGGCAGCGGCAGCGGCAGCTG
GCGCCTCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62