GenePrediction:GLEAN_2261 Details

Name: GLEAN_2261
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:70556..71046 (+ strand)
Length: 491
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:70556..70740 (+ strand)
Length: 185
Type: CDS
Source: GLEAN
Position: GCSC_140:70800..71046 (+ strand)
Length: 247
>GLEAN_2261 class=GenePrediction position=GCSC_140:70556..71046 (+ strand)
ATGATGCCGCAGGTGCCCACGTCCCGGCCCAAACCGCCGCCGCCGGGCGAGGAGGAGGCTGGGGCCGAGCTGCGGCTGGG
CGAGTTCGAGGGCGTGGAGACGCTGTCGTTGTCGGAGGCATGGCTAGTGATCAACGCCCTGATGGCCAAGCGGCGCAATG
ACCAGAAGAACGTGAACGAGACAGAGTGCGTATCGGACCTGTGGGCCACTGCTGTTGCAGCTCGCATCACTGACACCTTG
GCAGAGTCCTCACTAAGACTGTCGACTACCTGGACGCGTTTGCTCGGTTCAAGCGCAAGGAGAACGTCGAGGCGGTCGAG
CGGCTGCTGGCATCACACACGGAGCTGACCAAGTTCGAGCGTGCCGCACTAGGGTCGTTGTGCCCCGAAGGCGTAGAGGA
GGCCAAGACGCTGATTCCGTCGCTGACGAACAAAATTGGCGACGACGACCTGTTGGAACTGCTCGAGGAGATGGGCAAGC
TGCAGGGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62