GenePrediction:GLEAN_2263 Details

Name: GLEAN_2263
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:79291..81128 (+ strand)
Length: 1838
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:79291..79485 (+ strand)
Length: 195
Type: CDS
Source: GLEAN
Position: GCSC_140:79532..80002 (+ strand)
Length: 471
Type: CDS
Source: GLEAN
Position: GCSC_140:80064..80192 (+ strand)
Length: 129
Type: CDS
Source: GLEAN
Position: GCSC_140:80524..80559 (+ strand)
Length: 36
Type: CDS
Source: GLEAN
Position: GCSC_140:80634..81128 (+ strand)
Length: 495
>GLEAN_2263 class=GenePrediction position=GCSC_140:79291..81128 (+ strand)
ATGTGGACGACATTTGCTCTTCTGTTCTTGATTACGTTGGCATTGAAACTTCCCTTTGTATCTGTCAATGCCAGCCCCAT
TACCGACATCGTGGGGGCAGACATGTCCATCATTGACGCTAGTCAGGTTGTCTCTATTAGTGAGATTGACTTCACACAGC
TGCCAACTCTCAAGTGCAAGCACACATCTGACCAGGTAAGCATAATGCCGACAAGTCGTATCTGTGCCCTCTAATAATTA
GTTGTCCGTCATGAACAACTGCCGCGGCCTGGCCAACGGTTTCAAAGAGCTTTATAACAGGGACCACAAGCGCAGAGGCT
TGACGATTCCGACCGAGAAGTGCATCTCAGTAGAATATGGGGCTTGTCTCGGCACACTTTGCAACTTGGACGTGTTGGCG
AATTTCACGGATGTCCTCGAAGATCCTTTTGGTTCGATTATGGCCAATCCATCACAGAGCAGCTGCACCCAGAGTGCCAG
TGAAGTCGTCTGGTCCGATGGGCACACACTGGTACATCTGCAAGGATTGGGTACATCGGCAATGATCGTCAACGATAACG
CAGTCTCCCCGGACATCGATGTAGTTGAGCTCCACAGCACTAATTCGGTTTCGGCAGCCAAGGCTGCCCAGGGTACGGAA
TTTCCCTACGACACGGCACTGGATCTCTCTAACTGTCCTGGCTGGGAATACGGAAGATATACTTGCTGCAAGGTAAGATA
TAATACACATATTTGCACAAACGTGGATAAGAACAAATCTGACATTTTAACAGACGTCACGAATCATATGGGACGACTGC
ATGGAGGCAATTGAATTGATGGCAAATACAGGGGCAACAAAGATGATGGATGTTATGCAGAATTCGTGCCGTGCCGCGAC
GTCTGGTGGATGCACAGCGCAAGTATGTGCTAATGAAACGAGCGTGCAGGTAGTGCTGCATTATCTGCTTGATCTGCTGT
CATATCCTCTTAATGACGTGTGCGTTCAGAACAAAAAGATGGGCGGGGTTGTTATGTTGAATCCAGGCGTTGAAATTGCA
TTGACACCGGCAATTGACAACTAGGCGGAAGGCAGAACCCCGTAGGCCAGAGTTATACGGAGTGCGGAGTACTGAGTACG
GAGTACCAATATGGAGTCTTTAAATAGTCCCCACTACAATTGAGCAGCTAATCTACAAGTGGACATTTTCCATCGCCTTT
CTTACTATGTACTCCGTATGTTCACACCTTTAGCTTAATTTTGATAGCAAAGCATCGTCGTCTGCCATGGTGAGTTTCGA
CAGTCCAATTGCAGCGCAGCAGCCGATTACCATGCTGACTTTTCGAATTTATCCCAATGCTAGAATAAAGACGGCTGCTA
CACTTCGGTGCACATGCACCAGTCGCGCAATGCCGATCTGTTCGAAGATGTGTGCAAGGACCGCCTGCCCGATGACGACA
TTTTCGTGCCTCCTCAGCACCAGCCGATCAACCCCGAGGACGAGGACGACGTGGTGCCAGACCAGCATGCCGCCTTCGGT
ATCCAGAGGGCCACGCAGGCTGTGCGCGAGCCGGCCTGGAAGGATCTCGGTCTGGCTGCGCTGATGCACCAGGGGCCGGG
AGGCAGTAGTGGAGGAGCTGCTGGCGTCGCCGGTGCGAACGGAAGCGATGGGGGCAACCAGGGCCCCACGGAAAACACGT
ATGCATACTATGCCTACTACTACGGATACAGCGGCAATACGCTCGGGACAGTTGCCAGCGGCAGCGGCAGCGGCGCAGCA
GGTAGCAGCAACGTTACCGGAGGTGTCAGTCGCTCACACAGTGGCAGCGGAAGGGCATTTAATGGGATGCCGCGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62