GenePrediction:GLEAN_2264 Details

Name: GLEAN_2264
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:84665..85758 (+ strand)
Length: 1094
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:84665..85334 (+ strand)
Length: 670
Type: CDS
Source: GLEAN
Position: GCSC_140:85448..85758 (+ strand)
Length: 311
>GLEAN_2264 class=GenePrediction position=GCSC_140:84665..85758 (+ strand)
ATGCCTCCCTCCGTGTCCATCGACATGCTCGATGACAGCGTCGACTTCTCTGGCTTCAAGACGGCAGCGGGTTCAAAGAC
GAATGCCATTCGAGTGACGGCGCAGCAGCTGCCTAGCTCGAAGACCTTATTGCTTGCACCGCCGTCTGTCGCTTCCCACG
AGGAGAAACTACGGGCCGTCTTCGCCACGCATGACCGATCCACCTCTGACCTGCAGATGCTCGATCGAGTTGCCGCCGGT
CTTGTCACCCTAGTGCCAGCCTCGTACGATCTTGTTCTCGTCCTGACCGACACCAATGGCTCACACCGCACCGAAGCGCT
CCAGCTGCTCCAGCGCAGTGCTTATACAGCGTTGGTGCCGTCCATGAAGGTCGGTGCTAAGCTGCAGCTCCAGGACGGCG
GTCGCCTCCAGGGGGCAGAGGCGCGTGAGGCTATCCTCGCCGGCCTCGTGGAGAAGGATGGCGTGTTCGAAAAGACAGAG
GAAGAGGAGGCAGAGGTGGTCGTGCCATTGCGGTTCGGCGCGAAGAAGAAGACGGCGCCTGCAGCAGCTGTCGCTACGAG
CAAAGGCCCGGTGGTGACCTTGAATCTCGATGACTACAACGATGGCGACGAGCTAGTAGACGAAGACAGTTTGTTGACGC
AGGAAGAGCGAAACAGACCTCCTCAGCAACGTGAGTATCTCACCTCGTTAGCGATAGTCGTGCAAGCCGATGCCGCTTGT
AACCCCTGTCTCTCTGGCGATACCCCACTCTACCTACAATTGTTACTGACACCGGAACTGCAGCTCCCCAATGCAACGTG
GACGGCCAAAAGCGGCGACGGCCGTGCAAGGACTGCACGTGCGGACTTGCTGAGCGACTTGAGGAAGAGGACCGGACGCG
GAGGGCCGACGCCGACAACAACCTCAGCAACGTGTTCAAGCTGGACTCGGACGACCTCAACGAGCTGGACTTTACGATCA
AGGGGAAGACTGGGTCATGCAACAGCTGCTCACTGGGCGATGCGTTCCGTTGCTCGACCTGTCCCTACATTGGCCTGCCG
CCCTTCCAGCCGGGCGAAGAGGTCAAAATTATGAGCGGCCTGGTGCAGCTCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62