GenePrediction:GLEAN_2267 Details

Name: GLEAN_2267
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:90797..91674 (+ strand)
Length: 878
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:90797..90847 (+ strand)
Length: 51
Type: CDS
Source: GLEAN
Position: GCSC_140:90930..90950 (+ strand)
Length: 21
Type: CDS
Source: GLEAN
Position: GCSC_140:91044..91050 (+ strand)
Length: 7
Type: CDS
Source: GLEAN
Position: GCSC_140:91124..91204 (+ strand)
Length: 81
Type: CDS
Source: GLEAN
Position: GCSC_140:91284..91326 (+ strand)
Length: 43
Type: CDS
Source: GLEAN
Position: GCSC_140:91397..91558 (+ strand)
Length: 162
Type: CDS
Source: GLEAN
Position: GCSC_140:91623..91674 (+ strand)
Length: 52
>GLEAN_2267 class=GenePrediction position=GCSC_140:90797..91674 (+ strand)
ATGTCGACGCTTTCACGTACTCTCGGCTACCTGCGCCGCATTGGCATCAAGGTACGAGCGAGCCGGCCACGATGGCCGCC
CGAATTAACCGAAACGTGCACTGCTAACTTCTCGCCCTCTCGCCTCGAAACAGGAATACTGGCATCAACTGAACGTATGT
CGCCTCTCCCACAGGCCGGTCCCGGCCCAGTCTCTACTGCTTCCAGACACAGACTGACTCCAGGCGTCTGGATGCCCACA
AATCTAGTACATCGGTAAAGACCTCTCCCAGACAGGCATTGCGAGCCCACATCAGCACAGAAAGACTCACAGACCCCTTC
TTTATAGGTGACACCAAGGCCGGCACCCTCATGGGCGTCGACAAGGCCGGAAACAAGTACTACGAAAACATGGAAGAGGA
GCTGCCACGTGCGTAATGCTCGGATTCGATCTTTGCGCAGATGGAAGAGGAACGCTGACAGACGAACGAACTGGACCCCG
GAAACAGTGCGCACCCGTTGGATCGACTACAAGAAGCGTGACTATGATCCGTACGTGCGAGACCTAACAGACGGGCCAAG
GCTAGAGGAAAATGCTGACGGTGTATCTTTTTGTTACCAGTGGCCAGATCGAGCCTCTGTGGCACGCATGGCTCTCTTAC
TCCGTCGACCAGCCGCCTACACAGGATCCCTTGATGGCACTGGCTGATTCTCGCCCGTGGGTCACCCTGGAGCACAAGCC
CAACTACACGGCCACCCGCGGTGCCTTTAAGACCTACAACACGTATGTCATGCTCTTTCCGGCTCGCTAGGCCTCGACCC
GTCGTGCTGACTCTTCCGACCTTCAGAACCAAGCCCAAGATCAGCTCCTGGGAGCCGATCGCTGCGCCGCGTCAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62