GenePrediction:GLEAN_2269 Details

Name: GLEAN_2269
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:107363..112664 (+ strand)
Length: 5302
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:107363..107430 (+ strand)
Length: 68
Type: CDS
Source: GLEAN
Position: GCSC_140:107492..112664 (+ strand)
Length: 5173
>GLEAN_2269 class=GenePrediction position=GCSC_140:107363..112664 (+ strand)
ATGGGACAGCCGTCCTGTTCGTGGCCAATATGGCGCGTTGACGATTTCACCGTCTGCTTCCAGAGAGAGTAAGTCCGGTC
CTGCGCCTTCTCACTGCTGTTTGCCCTTACTGACACTGCTGTGCTCAAGCTATCTCAAGACCCTTTTTCCCGCCATCATC
ATCTCCATCTCTTTTCTCATTGTCCTCTCACAGACGCTTCTGCGTGCGGTCAAGTTAAAACGGACGACGAACTACCGGGC
GCTTCGAACCGATCTTGACCACACCGCATTGCCTCAGGCAGACTCAATTGACAGTGAGGACGACACCGTTGCTGCTGTGG
CAAGTCGCTCGGCAGACGATGCCGATGCCGATGACGATGACGATGACGACGGCCTTTCCATCAACACTGGCCGCAACACG
CTCGTCCGCACAATCACAAAGGGCTCGATCGTCCAGGCCGACACACCGGTCGGCCAGACTCTGTCTATCGTCGTCGAGGA
TCTTGCCATTGCCGGCCTTGTCGCCGTGAATGCCATCGCTCTCGCTACAGGTGCCTATGGTGGCAGTCGTTACGGCGCCC
CCGAGAAGGGCAAAGGCTCCATTGCGGCCGTGGTTGGACTGCTTCTCTGGGTATATGCTTTTGTTCTGGTCACGCTTCGT
CTGGTGTTGGTCAAGACGCAATGGCGCATTTCGCATCTCTGGAACCATACTGCCATTATCTATTTCCTGCAATGGCTCAT
GGATTCCGTCATCTGCCGCTCTGTGATCATTCACCCGACATCCCGCACTGTTGAGGTGCTCGTCATTGTCGAGTTTGCCC
TGACATCACTCCTCTTCTTTATGGCTATCACCACGCGGAAGGGCAACAAAACGGTGCTTCTTGAGTGGGAGGATGGCGTG
CCGCCGTCGCGGGAGAGCCTTGCCTCTTTGTTCTCGCATTACACATTCTCGTGGGTTGACAGTATCGTCTGGGACGGCTA
CCGAGAACCGTTGGAGATGAGCCGAGTCTGGAATTTAGACCCCAAGGACAAAGCAGCTGCCGTGCTCTCACACTACCGCC
GGATGCAGAAGCGGGCGTCGTTAGCCGCCCATCTGCTCTTTTTTTTCAAGGGAAGTTTGGCCGTCCAGGCCGGATGGGCC
ATTATCTCCGGTATTTTCACCTTTGCGCCAACTATGTTGCTGAAGGCTATTCTCGAGTACGTCGAGGATTCCAAGGGCGC
ACCCATCAATGTTCTGTGGCTCTATGTTTTCCTCCTGCCCATCACCGATCTGGTGCGTGCCGTTGGTGACAACCGCGCGC
TCTGGGTAGGCCGCAAGATTTGCATCAACATCCGCGCCATCCTCGTGGGAGAGATTTATGCCAAAGCTCTTCGTCGCAAA
GCTGCTACCGGCAAAGACTCCGTTCTGGGCGGCAGCGAGACCAAGGATGCAACACACGCCAAAGATAAGAGCTGGATAGC
GTCCATCCGGGGCAAGCTGGGCCTTTCGGCTAAGAAGAAGGGCGCTGCGGATTCGGCAAATGGAGCCAGCAAGAAGGCCG
GCAGCAGTGCGGACGCATCTGCCCAAGATGAGCAGGCTAATATCGGCACCATCATCAACCTGATGTCTGTCGACAGCTTC
AAGGTCTCGGAGGTCACGGCATATCTGCACTATCTCGTGGCTTCTGCGCCCACCCAGCTTCTCGTTTCCGTCTATCTTCT
CTACCGTGTCATGGGCCTGAGTGCGATCCCCGGCTTCATTGTCATGGCCGCCCTTCTGCCCATCAACATTGCGTTTGCCA
AGGCTTTTACCACGACCCAGAAGAAGATCATGGCTGCTACCGACAAGCGAATCCAGACCACGAACGAGGTGTTGCAGAAC
ATCCGCATTGTCAAATACTTTGCCTGGGAGCTTCGTTTCGGCAAGATCGTCGACGAAAAGCGTCGCATCGAGCTGCGAGC
CCTGCGCAAGCGCTACACCATCTGGGCATGTGCCGTTGCCATTTGGAATACTGTGCCCATCCTGATTACCTTCTTCTGCT
TCCTCGTCTACACGGTGATCGAAAAGAAGCCGCTGTACCCATCGGTCGCGTTCACGGCCATCTCGCTGTTCATGCTGCTC
CGGTATCCGCTCGACCAGCTCGGAGACATGATCGCCCACGTCCAGGAGTCCCGAGTGTCGATCGATCGTATTGAAGAGTT
CCTGTCCGAGGAAGAGACAGAGAAGTTCATCCAGCTTGGCGAGGAGAACATTGACGAATCCACCGGCGAGCGCGTCATCG
GCTTCCGAAACAACGCCAGCTTTATCTGGGGCGGCAGGGATGTCGTGGCCAGCGACGGCACGACGGCGTTCCGGCTGATG
GATCTGAACGTGGACTTTGCAATTGGCAAGCTGAACGTGATCACGGGACCGACGGGATCGGGCAAGACATCTCTCCTGAT
GGCTCTGCTTGGCGAGATGACGCTGACCCACGGCCGGGTCTACCTCCCTGGTGGGCGCAGCCGCGAGGATATCCGACCCG
ATCCAGAGACGGGGCTCGCGGAGTCGTGTGCTTATGTTGCGCAGCAGGCTTGGCTGGTCAACGGGACGATCCGGGAGAAC
ATTCTGTTTTCGTCCGCGTTTGACGAGCAGCGTTACCGTGACGTTATCGTGGCCTGTGCTCTGGAGCACGATATCGACGA
GACCCTGGACAACGGTGACGAGACGCTCGTGGGCGAGAAGGGCATCACGCTGTCGGGCGGCCAGAAGCAGCGCATCTCGC
TTGCCCGTGCGCTCTACTCGAACTCGCGTCATCTGCTCCTGGACGACTGTCTCAGCGCGGTCGACTCGCACACGGCTAAA
TGGATCTTCAGCAACTGCATCCGGGGCCCGCTGATGCGCGGCCGTACCTGCATCCTGGTTACGCACAACGTCTCGCTCTG
TGTGCCACACTCGGAGTACTCGGTCATCATGAACAATGGCCGCATTGCTGACCACGGCCCGACCCAGGGCCTCATTGACG
CCGGAAAATACGGCGATGAGGTGCAGCAGAAGTCGCTTCCCGGCTCGGCCACCATCTCACGGATCCCGTCGCGTGTCCCC
TCCAGCGTCGGCGACGAGGCGGAGAATGAGACGAACGGAACACTTGTGGACGACGGCGGAGCGGCTGACCCGTCGCTGCC
TAGCACGACTACTAACAGGACGAAGCGGGCTAAGCAGGCGGCGACGCGTCAGGACTCGACCGAAGAGACAAAGTCTACCG
GAGCTGTCAAGTGGTCTGTCATGAAGCTATATCTCTCGTCCATGGGCTCCTGGTGGTTTTGGCTTGTGGCCGTGCTCGTC
TTTTCCACGCAGCAGTTCAGTCTGGTGGCATCCAACCTGTGGATCAAGCAGTGGGCGAACCAGTACACGGAGGAATCGGC
TGACGCTGCGGCAACGATCTGGAACTCGACGGTGTCCGTGGCCACCGGCCTTGGAAGGCAGCCTTCAATATACGCTCGGT
CTATGGTGCAGCATGTGATGTCGCCCGACACGTCATCGTATCTCTCTACGGTGTCGCAGACGTGGATGCCCAAGAACTCG
ACTGTCTTCCAGGCCGATTCTGCACTCGCGGCAGCTATGGACCCCCAGGTCAACGTGCAGTACTATCTGCTGATCCTTGC
CATCATCGGCATTGCCGGATCAGTGCTTGCCTTTGTCCGCGATATCTGGATCTTCTTCGGCTCGCTGACGGCATCGTGGA
AGCTGCACGACCAGCTGATGCACTACGTGGCCTTCTCCAAGTTCAAGTTCTTCGACGTCACGCCGCTCGGCCAGATGATG
AACCGGTTCAGCAAAGACCTCGAGGCCGTCGACCAGGAGGTGGCGCCTGTGGCGATCACCGTGATGACGTGTGCGCTCGG
CATCGTCATTACGATTGTGCTCATCGCCATGATCACGCCTGGCTTCCTGGTTGCCGCCCTGTTCATCACGGTGCTGTACG
TGCTTCTGGGCAAGTTCTATCTGGCCTCGTCACGTGACCTGAAGCGTCTTGAGTCGGTGCAGCGCAGCCCGCTCTTCCAG
CAATTTGGCGAGACGCTGTCGGGCGTGACGACCATCCGGGCGTACGGTGACGAGCGGCGATTCGTGCGTGACAACCTGGC
ACGCATCAACGCGCAGCTCCGGCCGTTCATCTATCTCTGGGCGGCTAACCGCTGGCTCTCGCTGCGGACGGATCTGCTGG
GCAACATGGTCTCCTTCTTTGCCGGTGTGTTTGTGATTCTGAGCCTAGGCCTGATCGACGCCGGGTCAGCGGGCATCTCG
CTGAGCTATGCGATCGGGTTCGCGGAGAACATCCTGTGGCTGGTGCGGCTGTATGCGATGAACGAGCAAAACATGAACTC
GGTTGAGCGCATCAAGGAGTACCTCGAGGTCGAACAGGAGGCGCCTGCTGTCGTGGAAGACTGCCGGCCACCGGCCAACT
GGCCGAGCCAGGGTGCAGTCGAATTTGTGGACTATACGACGCGCTATCGGGAAGACCTCGACCCGGTTCTGCGGCATCTG
ACCTTCCGCATCGCCCCGCACGAGAAGGTCGGCATTGTCGGCCGCACTGGTGCTGGCAAGAGCTCGCTGGCTCTGGCGCT
GTTCCGCGCGCTCGAGGCAGAGACTGGCAAGGTGCTCATCGACGGGCTCGATATTGGCCAGATGGGGCTCCGGGATCTTC
GCGAGGCCATTACTATTGTGCCGCAGGAACCGACGCTGTTCATGGGCACGATTCGCAGCAACCTGGATCCGTTTGACAAC
TATAGCGACGAGGATATTTTTGCGGCCCTTCGCCGTGTGCATCTGATCGGGCCAGACGAGCGGATTCCCGGCGAGCCGCT
CGGAGAAGCGACTGCCGCAGCAGAAGGCAGCAGCAGTAGCAGCGAAGCAGACGTTCCGACGCCAACATCGCCAACAAACA
AGAACGTCTTCCTCGACCTGTCGACAAGCGTGGCCGAGTCGGGCTCGAACCTGTCCCAGGGACAGCGCCAGCTCCTGTGT
CTTGCACGGGCGATGCTGAAGAACCCCAACGTGCTGCTAATGGACGAGGCCACGGCATCGATCGACTATGCAACAGACGC
CAAGATCCAGGACACCATCCGCGAGCTGACATCGACCATCATCACAATTGCCCATCGGCTGCAGACGATTGCCGACTACG
ACAAGGTCCTGGTGTTGGACCGCGGCTCGCTCGTCGAGTATGACCACCCGTGGAAGCTGATGAGCAAAGAGGACGGTGTC
TTCCGGTCGATGTGTGACATGAGCGGTGACTACGAGACGCTGGCCAAGATTGCCAAGAAGGCCTTTGAAACGAAGACGCT
GATCGACGTGGAGCAGCAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62