GenePrediction:GLEAN_2270 Details

Name: GLEAN_2270
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:122427..126403 (+ strand)
Length: 3977
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:122427..122557 (+ strand)
Length: 131
Type: CDS
Source: GLEAN
Position: GCSC_140:122612..122756 (+ strand)
Length: 145
Type: CDS
Source: GLEAN
Position: GCSC_140:122817..122875 (+ strand)
Length: 59
Type: CDS
Source: GLEAN
Position: GCSC_140:124590..126239 (+ strand)
Length: 1650
Type: CDS
Source: GLEAN
Position: GCSC_140:126295..126403 (+ strand)
Length: 109
>GLEAN_2270 class=GenePrediction position=GCSC_140:122427..126403 (+ strand)
ATGTCGACGCTTCAGGAAATGCGGCAGCTGGGCATCGACCCCTCACGTCGGAACGCACGGGCGCGCCCTCTGGCCGATGA
CGAACGAAAGGCTCTCGAGCCGTTCTTGGACAATATACATTACTCGCAGAGGTCTGCTTGCTTGCCCTGTCGCCACCCAG
CTCTGTACTGACTTGGGGACCGTAGATACTCCGATGATGAATACGAATACCGACACGTGCTGCTACCGAAGCAGATGCTC
AAGCTCATTCCGGACCAGTATCTCGACCAGAGCAAAAAGACCCTGAAGCTATTGTGGGAAGACGAGTGGCGGTCCATGGG
GATTACACAGGTACTTGCTTGCGCTGAGCTGCGTGCATGCTACGATACCGTCTGCTGACATCCCGGCTAGAGCCTCGGCT
GGGAACACTACGAAGTCCACGAGCCTGAGCCACACATTCTACTTTTCAAGTGAGTCTTGTCGCCCGCGCATGGTGGCGTT
GCAGGCGAAGGAAGCGTGGAACGGAATGCTAACCGAGAGTGCGCTTACTCTGTTCCAGGCGGCCAATTAACTACCAACCA
CCTGCAAATTGAGCTACTGCCTTGCAGAGGTAGGCGACAAAAAGCGAATCGCATAGCGATCACGTCCCCGAGCGGCCTTT
CCCCCGCGGCGGCCATACTCGACCTTTCTTACTGCCCACTCGGTTGCGTATGGCAGCACCCTATCTCAACAGACTTACGA
ACGCGGCCGTTGATTCTTAGTTTTTCCTTTGGGGTGGCGCTGGAGACGCAAGGGGATATGTCGAGGGGCACCACAAATGC
GCCACCAAGACAGAAGCGCCGGAGCAGACGGGGATGGAAGTGCTGCAAATCGGCACTACTTGACAACAGCGGATGGCAGG
AAGCTGGAAAAGGGCTGCTAGAAAGCGAATGGGCTTGCATAGCATTCTGTGGGCGCGCAGCCTTTCTGCAAATGGGTTCT
TCCGGTTGGTGTTTCTTGGCTTCAGGGTTTCTCTCGGTGTTACTCGGATTGAAGAGTGCTGGATGGCTGTCGCAGTTGTA
TGATTATTGGCAGAGCGTGAGAAAAATCGGGCATGCTGATTGAATTTACGAGATTCGACTCGAGAAGAACGCACGGCGCA
TCCTTGCAGCCTGGTCCACTGTCGTCATTGAATGTGCACCTGACCAATGAATGTAATGAGCCCCATCTCAGCCGTTGTCC
CGAGCCAAGCCTGTCAAACCGTCTGGCCTGACGAGGCCACTTTCACCGCATCTTACCAGTTTAAATCGTCGACGCATCTG
CTGATTCTCGTGTCCGATCTGGACACATATCCTTAAGCTTTGCCTGCACTCGTCACGCTAAGTAGAAGCGCCTATGTCTT
TCGATTTCAAATCTAGAATTGTTTCGAGAACCGTATGAGCTGCTTGGCATTTTAGTGTTCTTTGTCATCAAGTCTTCTGC
AACGGTGGCCACATTCTCCGTCGACTACAAAACGTCCAAGTAGATCGTCGGTATTTGAGTGGGGCCCCCTTGCCGCTTTT
TTTTGTTTCGCCTTTGGAGAGGTACATAACTTGCATTTACTACAATTATCCTTCAAATCATCATCTCGTTTGTATTATTG
GTAGCCGGCTCTAGCAGCACTCTCCCATTCCAGCGCAGACCTCGTTCTCTTCAGGTGAGCATTCAGTGTTCTCATGGTGG
CGTTTTGAGCTTGGACGACTGACGAATGTGATGTAACATAGATACAAGTACAGGGGCTTTGGCCAGCCATACATCCAATA
CCAGTTTCAGACCCAACAATTGAAACCGAGCGCATTTGCGCTGCTCCTGGGCCCTTGTGCCGTATCGTCCAACCTCTTCA
TCTGTTCTAGATGTGCCAGTTGACATATAAAACGAGCGTCTCCTGAAACCCGCCCGCCTACGTCGCATACCGTCGCTCCT
TCAACGGGGAGACAAATCGAAGCAATGAAACCAGCTTCTAAACTTTTCTATCTGAACGTCTTTGCTCTTTGGAGTCCTTT
GGGCTTCTGCCAAAACTCGCAAGATGCCTGCGTGGTATGCCACATATCAGACTCATCCTCGCCCCTCATCACACTCATAT
CCTAGTCTTCGTTGTCTATGCTTTTTTCTCGTTCGATGGCACGTTGTCATCTTGGGGCTGCTCTCCCTTCACGCTACTGG
CAGCTCCGCCGCCAGATCTGCACCCTCACAGTACCACTTTGTTGTGTCTAACAAGTCCTACTATCAGATCTCACCGAAAG
CCATAGTCTCTGACGCTTGTGCTTCCTACTCCACTCTCGAGAGGCTCAACGAAAGGGTCTTCCCAGCCGTGACCGATCTC
ACCAAGACAACTGACTTCTTCAGCCACTACCGAGTCAATCTTTTCCACAAAACATGCCCCTTCTGGAACGATGATGACGG
CATGTGCGGCAACATTGCCTGTGCCGTGCAGACGCTAGAGAACGAGGAGGACATCCCAAAGATCTGGAGGGCCAGTGAGC
TGGGCAAGCTCGAAGGCCCGAAAGCCCAGCACCCGGGAAAGCTGACCCAGAAGCAACTGCCGCAGAATCCACTGCGGGGC
GGCTTGGGCGCAAATGTCGGCGAGAGCTGCGTGGTCGAGTACGACGACGAGTGCGACGAGCGCGACTATTGTGTGCACGA
GGACGAGAGCGCCGGTTCCAAGGGCGACTACGTGAGCCTGGTGCAGAACCCGGAACGGTTCACAGGTTACGCAGGACAAG
GCGCTCAGCAGGTGTGGCAGGCGATCTATCGCGAGAACTGCTTCCAGAAAAGCTCGTTCCCTCACTCGGCACAGCTGGGC
TCTGGGCCACCGGCCAAGGGACCAGCAGCTCTGGACTTCCGGACGGTGCTTGAAGCCGCTGGCCGGCAGCATGCATTGGA
GCAGCAGCGTCAGCAGATGCCCAGCACGCCGTTTGTAGCGATGACGGGCCTCGAGGTCGAGGACGAGTGCATTGAGAAGC
GCGTTTTCTACCGACTCATGTCTGGCATGCACGCATCCATCAGCACGCATCTCTGCTGGGATTTTCTCAACCAGACCACC
GGTGAATGGACGCCCAACGTGGAGTGCTACGCCAACCGTCTGCAAAAGTTCCCGGAACGCATCAGCAACCTGTATTTTAA
CTATGCCGTGGTCACACGGGCGATTGCCAAGCTGGGTCCCCACCTGTCGTCATACACCTTCTGCTCGGGCGAACCGGAAC
AGGACCAGGCTACACGGGCCAAGGTGCTGGCTGTGACGGACAAGGCAGCCAGCGTGCCGCAGATCTTTGACGAGTCGCTC
ATGTTCAAGAACGGTGAGGGTCCCTCGCTGAAGGAGGACTTCCGCAACCGGTTCCGCAACGTGAGTCGGCTTATGGACTG
TGTGGGCTGTGACAAGTGCCGGCTTTGGGGCAAGGTGCAGACGGCCGGCTATGGCACGGCGCTGAAGGTGTTGTTTGAGT
ACGATAACGACGGCAAGGTCCCGCCGCTGGAGCGCACCGAGCTTGTGGCCCTGTTCAACACGTACGCGCGGATCAGCAGC
TCTCTGAACGCGATCCAGAAGTTCCGCATCATGGCTGCGAATGACGAGACAATTGTGGCAGCTGCCAGCGCTATCGCAGA
CGAGCCGGTGCAATCGATCTCTGACCGGGTGCGGAAGCCGCACCACGTCATTGTGCCAGAGCGGTCTGATAGCACGGCTG
CTGGCGAGGACGAGGAAGTGTATGACGAGTCTCATTACCCCTCTATCGGAGAGTGCATTGGCGAGGAACTAGACAACGTC
CTGAAAGCGTTTAAGTTTCTCTTCGAACGGTACATCGCCTTCCCTCAGATGATGTAAGCTGCGCCGTTTTGCCCTTCCCA
ACTGCGTTCGACGCTAATAAGCGAGTAGGTGGCACATTATCTCGACAGAGCTGCTGCGTCTGTGGCAGTTCTTTATCGGG
CTGCCGGTTCGGCCGCGATCATGGGCATTTGAGCGGCCAAGCGTGGACGAATTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62