GenePrediction:GLEAN_2271 Details

Name: GLEAN_2271
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:129997..133859 (+ strand)
Length: 3863
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:129997..130404 (+ strand)
Length: 408
Type: CDS
Source: GLEAN
Position: GCSC_140:130470..130833 (+ strand)
Length: 364
Type: CDS
Source: GLEAN
Position: GCSC_140:131277..131421 (+ strand)
Length: 145
Type: CDS
Source: GLEAN
Position: GCSC_140:131484..132082 (+ strand)
Length: 599
Type: CDS
Source: GLEAN
Position: GCSC_140:132131..133078 (+ strand)
Length: 948
Type: CDS
Source: GLEAN
Position: GCSC_140:133132..133859 (+ strand)
Length: 728
>GLEAN_2271 class=GenePrediction position=GCSC_140:129997..133859 (+ strand)
ATGGCATCATCCGTGCAGACCAAGCAGACGTCCAGTCACCCACGCAAACGCCAGTCTCGTCGTCGTGGTCTTCCGCTTGC
CGACTCGATCGATATACTAGACAAGACTGGGTTCGGTGGTGCTTATCACCATGGCGGGCCCTATGACGCAACTCTTGCGG
CCGTGAATAAGAACAAGAAGTACGCGCCTCTGGAAGCTGTCAAAGATTCCAACCTAGAGGCGCTACGAGCGACGCCAAAA
GAGTACATTGTGGACTCACTTGAGCGACACATTCCCCTACAGGGGACAGGAACGATACCGTCGGGCATGCCAGACATGAA
CGGAAACATCATGAACTACAAGGAGGGCGCAGATTTGATGCGTGAGGCTGATGCGCCGGGCGGGGCGTTTATGCGCTACG
ATTTCATCGTGAGTATCCCTACCACGGATCTTTTGTATTTGTGTCTGTACGCAGACTGCTGACTGTGTTGTAGAAATACC
ATCCCGACGATCTCAAGGGCAAGGGGGAGCCATCGTTCAGCATCGAGCGCAGCCTCAAAGAGCAGTCAAACAAGCCGTAC
AGACACAAGGTGTCGGCCAGCTACAGCGGCGGCAGCACGTATGAGATGAAAAACCAATTCCGGCCGCTGTTGACGCCACC
CAAGGATGCCAATGCGTCGATCCGCCGTTCAAGCTTCAGCAGTTCCGCAACGGGTGCGTCCTGGCGGTCGCCATCACCAC
TGGGCTCGGGCTTGCGGCCGCGCGCCCAGGACGACACCATCTACTCCACCCAGACGGACCTGAGGCGGAATGCCAGCCAC
GGCAACCGCATCACAGAGGGGCTGAAGCGACGGCTCGGTAGCTTGCGGCGGAAATAAGCACGGGGGCGAAGAATGATAGG
ATATTGATTGGATTCAGGGCTTGTTAGAGATATCACGATGTTTTCGCATTTCTTTTTTCTTGGTTTATACGTTGTAGAAG
TGGGGCTTTCACGGTTTGAAGTAGACGGTCAAGGTTCTAGACAGTCATAAAAATTTTCAAGATTTCACATTGTCGATTCC
TCTCACCGAACACAAAGATAGGATGCTCACCTATGACATAGTGACGCGAAAGAGGAAGGAGATGGCCCGTGCGGCTAGCT
TGTCGCTTCCCCGCGAGCACCGTTGCCCCTAACGAAGGAGCTCCTGCGCGCAGGGGTGCTTTCCGTTCTGGGAAGCCTGT
CCTTGTCATTTTCGCCACACCACCGTATAAAGTTGGCCACGGTGGACCGAAAAGCAACTGACGAGCAAGGCCACTGCGAG
ATATCGCGGCTGGCCAGGCAACTTCCGACCGACTCTCCCAGCGCACGCATCCACACGAGAAGACGAGTCTGGTGTTTACA
AGCACACGCCCTGCAGCCATGTCGCTGGTGCCTTTTCATCCACAGGAGGGGCGCGAAATCGTTCTGTAAGTTTCGGGGCA
GAGATCTGGAGACGGTTTGTTGCTGACAGCCGGAAATCTGCAAACAGCCGCCATCGCAATGCCATTGTCGTGCGCGACCC
GTCGTCGCAGCGGCTGGAGATCCGCGGCATCGCTGAGTGTCCGACCTGCCACCGGCCGATGCGCGCGTCATCGCCCACTC
GCTCGCCGTTTGCCTCTGATGTCGATGGTGACTTCATCCACCGTCACGAGGGCTATGTCGACCCCAACTACTTTCGCATG
CTGCGTGCCGGCCACCACCAGCTGCGCGGGACCGACCATCCGTCCCACGGCACGCCGTCCAGCCCTCTGCGGCGTTTCTT
CCAACCGCTTGTCGGCCAAAGCACCCCGGGCGGAAATTCCAGTCCGGCCGGCAGCACTGCCAGTGGAGCTTTGTCGGAGG
ATGAAGACGCTGCCTCTGGGGGCTCTCCGAAAGCAGGCGCTACTGCAACCCTGGACTCGAGCCCCATCGGCAAAGAGGCC
TTCAGTCCGCACTATTTCAAGACCTTCTTTGTCGAGGAGCGGGAGCTTGGTCGTGGTGGCAAAGGTGTCGTCCTGCTCGT
TCGACACGAGATTGACGGCCTTCAGCTGGGCCACTTTGCCTGCAAGCGTGTGCCTGTCGGCGATGATCATGCCTGGCTTG
AGAAAGGTGGCTGCCCCTTTTTCCCTGTGTCGTCTCGTGTACTGACTCTCCTAGTTTTGGTCGAGGTTGAGCTGCTGGCC
AAGCTCTCCCACCCAAACCTCGTGTCCTACCGCCATGTCTGGCTCGAAAACGTCACACTCAACCGCTTCGGCCCCAGCGT
TGCCTGTGCCTTCATCCTTCAGCAGTACTGCAACGGTGGCGATCTGCAGAATTACATCATCGGCGATCAGCCCAAGGAGG
CGACCAAGGAAGAGCTCAAGGCCCAGATGCGACGACGGTCCAGGGGCCAGGCCGAACGGCCTCGAAACCCGTTTTCACCC
TCGGCTGCATCTCGCAGACAGCTGCAGTTCGACGAGATCTACTCCCTCTTCCGCGACATCACCTCCGGCCTGGCCTACTT
GCATGCCGCTAACTACATCCATCGAGATCTCAAGCCCAGCAACTGCCTGCTGCACCGCGAAGGCCGCAATCTCACCTGTC
TCATCAGCGACTTTGGCGAGGTCCAGCCGGAGAACGTTGTCCGCCGGTCCACCGGCACTACCGGCACCATTTCGTACTGT
GCTCCCGAGGTTCTCCGGCGGGACGCCAATGGGCTGTACGGCAACTTCACCACCAAATCAGACATCTTCTCCTTGGGTAT
GATCCTGTATTTTATGTGTTTTGGCCGTCTGCCCTACCGCAGTGCCAACACGCTCCACGAGGAGCTCGAGGATATTACCC
AACTACGTGCCGAAATTTCCAACTGGAAGGGCTTCCAGTACGAGCGGCGCGAGCGGCCAGACCTTCCCTCGAAGCTCTAC
CAGCTCCTCACCAAGCTGCTGTCCGTCCAACCGGCCGAGCGGCCCAGTGCGACCGATGTTCTGCTCGTCATGCGGACCAC
CGAGTCCGGCCTGGACGGCTTCTCGCGCAATGGGAATTCCACCATGAGCCAGACGATGAATATGTCCGGTCGCCGGCTTC
AAAATCTCGACTCAGGCGTCTCGTCAGGCACGTCTATGCCAGGTGCGTCTTCATGCTTCTGTCTTTGTTCGACTTGTCTC
TAATGTGTCTGTCAGATACCGTGAATACCAGAAAGGGAAGCCTGAATTCGCTTTCATCCCCGGCGGATCACCTGGACGAG
TTTGCCGTTGTGGACTCAGACGACGCCTCGTCGCCGAAATTAACGCCCCGGGACAGCCTGCAGAAGAGCAGGCCATCCAC
CCTGACGCTGACGCACAGCCAGGAGAGAGGTCTGAACCGGTCTCCCGAACGGCGGACTGCAGCTGTTTCTGACAGCTCCG
GGCCCCGCTCTCTGTCGCCCGGTGCCCCAGCTCCGTCGTCTCCGCAAAACACCAACACGCCTCTCCTGATGCCACCTCCG
GCCACCTTTCTTGGCGAGATACAACACCGGACACGACTGGCTCAGCACTTTGTCCTGCTCTTTTCTCGGCAGCATGCGGA
GGCTGTCACCTTTCTTCTTCGCATCACTCTCTTCTTCCTTAAAATAGTCACCCTCGCGAAGCCTTGTTGGCCATTCATGG
CCCAGTGGGGGATCGGTGCGCCCCTCGTGTTTGTCGCCGGGTTGGATCTGGGGCTTCCTGATGAAAGCGGCGGACGTTTG
GGATTCCAGCAGGATGAAGCCCCTCAGTATCGTCACAGGCCCCGTCCGAGATCCCCGTTTTGGGAAAGGAGCTGGCGTGT
GAGCATGCTCTTGCTCGCGCTGCACTTCTTCATCTTGTGGACTGCTTCCCACTCAGGAGTTCTCTGCACGGTCAACAGCC
ATAAGCCGTGGACAGAATGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62