GenePrediction:GLEAN_2273 Details

Name: GLEAN_2273
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:139881..141231 (+ strand)
Length: 1351
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:139881..140009 (+ strand)
Length: 129
Type: CDS
Source: GLEAN
Position: GCSC_140:140071..141231 (+ strand)
Length: 1161
>GLEAN_2273 class=GenePrediction position=GCSC_140:139881..141231 (+ strand)
ATGCGTTTCTCCTCTGTGGCCACGGCCCTGCTGGCCACTGCCCAGTATGTTGCTGCGGCTCCCTCTTTTCCGGCGATTGA
CAACAAGCACAACGGCAAGATCGCACCGAAAGTCATGATTGTCAGCCTGGTGAGTTTCTGCCTCTCTTCTGCTCTCTGCC
TGTTGTGTTGCATGTGCTAATTCTGGTCAGTTCCACCCCGAAGCCGCTATCTGGTACAGCAATCTGCCTAGCAGCGGTCT
AGGCAATCTGATGGACGTCAACATCACGGCGCCCGGACTGTCGATGCTTTTTCCCCACGTGCACTGTGTGGCCGATCACA
GCATCTGCCAGATGACCACGGGTGAGTCGGAGATCAACGCAGCCTCAACCGTCATGGCTGCCGTGCTCTCGGGCAAATTC
GACCTGACCGAGACGTACTTCATGATCGCCGGCATTGGCGGTGTCAACCCCAAGTACAGCACGCTGGGCGGCGTTGCTCT
GGCCCGCTACTCGGTGCAGGTGGCCCTGCAGTACGAGTTTGACGCGCGCGAGATGCCGGCAAACTGGTCCACCGGCTACT
TTGGCTACGGCACCGAAGAGCCCGACGTCTACCCCGGCAACCAGTATGGCACCGAGGTGCTCGAGGTCAGCGAGACGCTG
CGCGACATCGCCTTTGGCTATGCCAGCAAGGCCAACCTCACCGACGACCCGATTGCGGCTGAGTACAGAGCCAGGTATGC
GGCCGCGGCTGACGGCATCTACACCGCCGGCACAGCTGTGCCCTCGGTCGTCAAGTGCGACACGGCTACCAGCGACGTCT
ACTACTCGGGCACCATCCTGGGCGAGGCCTTTGAGAACGTCACCAAGGTGTGGACCAACGGCACGGGCGAGTACTGCATG
ACCGCGCAGGAGGACAGCGCCGTGCTCGAGGTGCTCGTGCGCCTCGCCATCGAGGGCATGGTTGACTTCAAGCGCGTCAT
CCTCATGCGCACCGGCTCCGACTTTGACCGCCCGCCACCGGGCATCACGGCTTTTGCCAACCTGGTTACCGTCGATCAGA
ACGGCTTCGAGATTGCCATCAAGAACATCTACAACGCCGGCATCGAGATCGTCAAGGGCATCCTGAAGAACTGGGACTGC
ACTTTCAAGGAGGGCGTCACGCCCACCAACTACGTTGGCGACATATTTGGCAGCCTGGGCGGTGAGCCTGACTTCGGCCC
CGGCAGCCTGACCGGCGGCATCGGCTACCTGCCGGGCGGCCGCTCGGGCGACCTGACCAAGCGCAGCACCAAGCTGACTC
GTCGCACCGCCACGACCAAGCGTGCCAAGCGCGGAATTGTCGTGTCTGTCCGCCCGTCCAAGGAGCAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62