GenePrediction:GLEAN_2274 Details

Name: GLEAN_2274
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:146917..148695 (+ strand)
Length: 1779
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:146917..148695 (+ strand)
Length: 1779
>GLEAN_2274 class=GenePrediction position=GCSC_140:146917..148695 (+ strand)
ATGGCCGGTCTCTTACGGACAAGCCTGATCTGGGTCACCTACGCCGTGGCCGTCGGCCTGGCCCTGGTAGTGGCCACCAT
CACCACCTTCACCTGGCAGGCGCCGCGCGACAGGTCTGCTGTCGTGAGCACGGTCGCTGTCGTCAGCATAACTGCCCTCT
TGGCGACTATTTTCCTCCTTCCAGTCGACATTGCCCTCGTCTCGTCCACCACGAACACCTCTCTCGGCGCAAAGAAGGAC
TGGGCCACGCCCGAGCATGTAGAAGGCGTGCTCTTCACCCTCAAGGTCGTTTACTACTCGCTGTACAGCTTTGACGCGTT
GCTGTGCCTCATCGTCATACCGTTCACGTATTTCTGGTATGAGGAGTACGACGAGCTCGACCGGCAGGAGGATGCCCACC
GCAGCTCGCGCAGCCGGATCTGGGGCGCCCTCCGGTACACCAGCATCTTTGTGGCGCTCGTCGCGGCCCTCCTCCTGGTT
GGCTTCTTTGTGCCCGCTGCAGGCGGAAAGAAGGGCGACAGCCACGTTGATTTCGACTACCTCCGGCGGCTTCTTGCCGA
GAACAACGGGGAGAAGGCGCTCACGTTTGGCGTCGGCTTCCTGATGACCATCGGCACGCTCTTGTATGTGCTCTATACCG
GTGCCGGCATGGCGCTGTTGCCCATCTCATTCATCAAGTCGGCCCCGTCGGTTTCGGCGCCCCAGCTGAGCCAGACGACC
GCTTCGGCGCTGGAACAGAACCGCGAGCGGCAGCGACAGCTGGATCTGCGCAATTCCGACCGGTCCGGCGGGATGTCGAC
CAAGGACCGGCGCGAGCTGGAGACGCTCATGCGAGAAGAACGAACGTTGGTGCGCCGGGAGAGGCTTGCGGCAGAGGCTC
GCGGCGAGGGCCACAGCAGGATCTTCCGGACGTGGACGAAATTGTGTGCCGTGTTCCGGCCGCTGACGCTGATCGGCGGC
ATGCTCCTCATGCTACTGTCGCTCGTCGTGGCCGTTTCCATGCTCATCACAGGCATCGACAAGGCGGCGAACTCGATCTG
CAAGCAGCGCTGCGGCTACATCCTCGGCCATATTAACGTCTTCCAGCCGATCAACTGGATCTTCATGCAGACAGCCCGAG
TGTTTCCCGTCGACTATGCCCTCTTGGCGCTGCTCATCCTCTTCCTCTTCAGCAGCTCTGTCTCGGGACTCGCGGCTGTC
GGGATCCGCTTTCTCTGGGTGAGCATCTTCCAGTTCCGCAAGGGCCGGACTGCGCCGCAGGCTATCCTGATGGCGACAGT
GATGCTGGCACTGATCATCCTGGCACTCAACTATTCCGTTGCCATGCTTGTGGCTCCGCAATACGCCAGCTACGGGACGC
AGACGTTCTGTCTCAACCCACCGGCGCATCCCGGTGAGCAGCCCGACTGCAGAGACCATCCAAACTGGATCAAACCATGT
TCGGAGGCGTACACGGAAGCAGCAGCAAAGGACGTGTGCACGCCGACGGTCATGTCGACCTTCATCAACCGGGTGACGCT
CAACTGGCCGGTGTTTGGAGCTGTGGATTTCTGGGCGCAGTTTGCCTTCTTGGCTGTCTTCCTTATTGTGTTCACAACAT
CTCTATTTAGGACGCCGAAGCTGGACGTGTCCAGGATGGATGAGGATGCTGAGGCGGATGAGGAAGAGGGTCTGCTGGCC
AGCACGGGGCGCCGCTTTGGAGCCACATGGCAGAACATCACGGGCCATGCCACGCAGAATGGCGAGTCGGGTTACGGAAC
GGGATCTGGGGCAAACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62