GenePrediction:GLEAN_2276 Details

Name: GLEAN_2276
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:159380..163372 (+ strand)
Length: 3993
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:159380..159382 (+ strand)
Length: 3
Type: CDS
Source: GLEAN
Position: GCSC_140:159612..162954 (+ strand)
Length: 3343
Type: CDS
Source: GLEAN
Position: GCSC_140:163014..163372 (+ strand)
Length: 359
>GLEAN_2276 class=GenePrediction position=GCSC_140:159380..163372 (+ strand)
ATGGTAAGTCGAAGTTGCAGTGCTGGACGCCGGGACGGGGCCGGGCTCCCTTGGCCGGGGCAGCCGGGCTGGGCGTCGAT
GCAAGTCCCCCCCTGGATTGTTGTGACAGACGCTGACACGGGCTTCCGGGCGGGCGCAGGCTATTACACGAAGAGCAAGA
GACAAGCAGGCGAAACCCGAACGGGCGGGCGGCGGCGGGGGCAGCGGCGGAGGGGCAGCGCGGCCCAAGAAGGCCACGTA
TGACACGACGAAGAAGCGGGAGATCGGAGTGTCGGATCTGACGTTGCTGAGCAAGGTGTCGAACGAGGCGATCAACGAGA
ATTTGAAGAAGCGATTTGAGGGTGCGGAAATCTACACGTACATCGGACACGTGCTGGTGTCGGTCAACCCGTTTCGGGAT
CTGGGCATCTACACGGACGAAGTGCTGGACAGCTACCGGGGCAAGAACCGGCTGGAAGTGCCGCCGCACGTGTTTGCGAT
CGCAGAGGCGTCGTACTACAACATGAAGGCGTACAAGGAGAACCAGTGCGTGATTATCTCGGGCGAGTCCGGGGCCGGCA
AGACGGAGGCGGCGAAGCGGATCATGCAGTACATTGCCAACGTGTCGGGCGGTGACACGGGCGACATCAAGCAGATCAAG
GACATGGTGCTGGCGACGAACCCGCTGCTGGAGTCGTTTGGCAACGCGAAGACGCTGCGAAACAACAACTCGTCACGATT
CGGCAAGTACCTGCAGATCCACTTCAACGGCAACGGCGAGCCGGTGGGCGCAGACATCACGAATTACCTGCTGGAGAAGT
CGCGGGTGGTTGGCCAGATCACCAACGAGCGCAACTTCCACATCTTCTACCAGCTGACCAAGGGAGCGTCGGCGGCATAC
CGGCAGACGTTTGGGCTGCAGACGCCGGACACGTACGTGTACACGAGCGGGTCCAAGTGCTACGACGTGGACGGGATCGA
CGACGTGGCCGAGTTCCAGGACACGCTGCAGGCAATGGGCGTGATTGGGCTGACGCAGGCGGAGCAGGACAACATCTTCC
GGATGCTGTCGGCGATTCTGTGGGCAGGCAACATGGGTTTCCGCGAGGACGAGAGCGGATATGCGGCCGTGACAGACCAG
TCGGTGGTGGACTTTCTGGCGTACCTGTTGGAGGTTGAGCCGCAGCGACTGGTGTCGGCAATCACGATCCGGGTGCTGAC
ACCGCGCAGCGGCGAGGTGATCGAGTCGCCCGCGAACGTGGCACAGGCGGTGGCGACGCGGGATGCGCTGGCCAAGGCGA
TCTACAACAACCTGTTCGACTGGATCGTAGAGCGGATCAACCAGTCGCTGAAGGCGCGGCAGGCGGCAGCGAACTCGGTG
GGGATCCTGGACATCTACGGGTTCGAGATCTTCGAGAAGAACAGTTTTGAGCAGCTGTGCATCAACTACGTGAACGAGAA
GCTGCAGCAGATCTTCATCCAGCTGACGCTGAAGACGGAGCAGGAGGAGTACGCGCGCGAGAAGATCCAGTGGACGCCGA
TCAAATACTTTGACAACAAGGTGGTGTGCGACCTGATCGAGTCGGTGCGGCCGCCAGGGCTGTTCTCGGCGCTCAAGGAC
GCGACAAAGACGGCGCACGCGGATCCGGCGGCCTGCGACCGGACGTTTATGCAGAGCCTCAGCGGCATGTCGAACGCGAA
CCTGACGCCACGGCAGGGCAACTTTATCATCAAGCACTACGCGGGTGAGGTGTCGTACACGGTGGAGGGCATCACGGACA
AGAACAAGGACCTGCTGCTAAAGGGGCTGCTGAATCTGTTTGAGGCGAGCGGAAACGGGTTCGTGCACGCGCTGTTCCCG
AATCAGGTGGACCAGGACAACCGGCGACAGCCACCGACGGCGGGTGACCGGATCCGGACGTCGGCGAACGCGCTGGTGGA
CACGCTGATGAAGGCGCAGCCGTCGTACATCCGGACGATCAAGCCGAACGAGAACAAGTCGGCGACGGAGTACAACGGAC
ACAACGTGCTGCACCAGATCAAGTACCTGGGACTGCAGGAGAACGTGCGGATCCGACGGGCCGGCTTTGCGTACCGGCAG
ACATTTGAGAAGTTTGTGGAGCGCTTCTTCCTGCTGTCACCGGCGACGTCGTACGCGGGCGAGTACACCTGGACGGGCTC
ATACGAGGAGGCCGTGCGGCTGATTCTCAAGGACACGAGCATCCCGGCCGAGGAGTGGCAGATGGGCGTGACCAAGGCGT
TTATCAAGTCACCTGAGACGCTGTTTGCGCTGGAGCACATGCGCGACCGCTACTGGCACAACATGGCCATGCGAATCCAG
CGGATGTGGAGGGCCTACCTGGCCTACCGGGCGGAATCGGCGACGCGGATCCAGCGGTTCTGGCGCAAGAAGCGTGTGGG
GACCGAGTACCTGGAGCTGCGCGAGCAGGGGCAGCGGTTGCTGGGCGGACGCAAGGAGCGGCGGCGCTTTAGTCTGTTGG
GCCAGCGTCGTTTCCTGGGCGACTATCTCGGGCTCAATGCGGCAACAGGACCAGGCAGCGTGATCCGGAGTGCAACGGGC
ATCGCGGCCAGCGAGCGGGCCGTCTTCTCGTGTCGTGGCGAGATGCTGGAGGCCAAGTTTGGGCGATCGAGCAAGGCCAG
TCCGCGCATTTTGGTGGTGACCAGCAGCAAGTTTTATGTGATTGCACAAATGTTGGTGAACCATCAGCCACAGATCGTGG
TCGAGCGGGCGATTCCGCTGGGGGCCATCAAGTTCATCAGCGCTTCGACGAGCCGGGACGACTGGTTCGCGCTGGGCATC
GGGTCGCCACAGGAGGCCGATCCTCTGCTCACCTGCGTCCTCAAGACGGAGATGTTTGTGCAGCTGAAGCGTGTCATGCC
GGCCGGCTTCAACCTCAAGATCGCCGACGGCATCGAGTACGCCAAGAAGCCGGGCAAGACCCAGATGGTCAAGGTGCTCA
AGGACAGTCAGACCACCGCCGACCATTACAAGTCGGGCGCCGTCCACACGCAGCCGGGCGAGCCGCCCAACTCCGTCTCA
CGTCCGATGCCGCGTGCCAATCCCGTCGCTGCAAGGCCCATCACGCGCGGCAAGCTGATCAAGCCGGGCGGGCCCAACGG
CCGTCCATCACGGCTGGCCGGCAACCGTGCCACCCAGCCACGGCCGCTTCCAGGAGGACGAACTCCGACAGCTGCAACGA
TGCCTGCTGCTGCTGCTTCGATGCCGGCTGCTGTGCCGCATGTGACACAAGCCACACATGCACCAGCCACACACAGCCAC
AACTCATCAGCCACGCACAGCCACCCAGCACCAGCCACACGCATGCATGCCGCCGCCGCCAAGAAGCCCACGCCCACGCC
GAACCCCCGGCCTGCCGCCAGTCTGCCGTCTCACACGCGCAACACCTCCTCCAGCTCGTCGGCACGCGCGCCACCGCCGC
CGCCACCGGCACCGCCGGCAGCCAAGCCTAACAAGATCACGGCCAAGGTGCTGTACGACTTCCAGGGCCAGAAGCAGAAC
GAGCTGTCGATCCACACAGGACAGATTATCGACATTGTGCAAAAGGAAAACAATGGTGAGCTACTTCCTTTATCTTACTT
CTATTAGCTTTTCGCTTCTTTGCTAACCCCCCAGGCTGGTGGTTGGCCAAGGTCGGTGAGCAGCAGGCCTGGGTGCCGGC
TGCCTATGTGGAGGAACAGGTGGCGGCAGTTCCGGCCGTGTCACGTGCCCCGCCAGCGCCGCCACGTCGGCCTGTTGGCG
GTAGCAACGCCGGCAGGTCGTCGGTGGCGTCGTCGTCCTCGGCCGCCTCCCCCCTGCAGCCGCGCGACTCCGGCATGAGC
CTCAACGGCGTCAGCCACTCGTCCGATAGCAGCCGCGGCAACACGCCGACGCCGTCGGCTGCCGGCAGCACCGGTGGCCT
CAGCTTGGCCGACGCTCTGCTGGCACGGCAGCACGCCATGTCGACTCGGCGCGAAGAGCCGGACGACTGGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62