GenePrediction:GLEAN_2277 Details

Name: GLEAN_2277
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:166714..169895 (+ strand)
Length: 3182
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:166714..166878 (+ strand)
Length: 165
Type: CDS
Source: GLEAN
Position: GCSC_140:166944..169895 (+ strand)
Length: 2952
>GLEAN_2277 class=GenePrediction position=GCSC_140:166714..169895 (+ strand)
ATGAGTTTTGCCATCGAGGTGCCTGGCGAGGCGGTTCCGTTCAATATCCCGGACCTTTGCAAGGCCTTGCAGGCCGGCAC
CTCATCCGATCACAACCAACGACAATCGGCAACGCAACAGCTCGACGAATGGAAAACCCACCCGGGCTTTTATTCTGCCC
TGCAGGTAAGCTTGTTCCCTGTCCCTCGTGGGCGCCTTCCGCTCCAGTTACTGACAGCAGCCTTCCACAGAGTGTGTACC
TCGAGTACTCTCTCCCCAGCAGTGTCCGGCTGCTTGCCATTATCATGCTGAAAAATGGCATCGACCGCGACTGGAGAGGG
GCTGCCAACGCCCGGGGTGGCATCCAGCCGGACGAAAAGGCCCGCATACGAGCAAGGCTATTTGAGGGCACCATCCGCGA
AGAAGACAGGACCCTGGCCCGGCAGAGCGCCGTCCTCACCGCAAAGGTCGTCCGCATTGACTACCCGCAGGAATGGCCCA
CGGCGCTGCCCGAGATCGTCTCCATTCTCCGCAGCGTCAAAGACTCGAGCCACGTGCAGCTGCACGGTACGGTTCTGCTG
CTCCTCCGCGTCATCAAGGAGCTGTCGACGGCCCGGCTGCGCCGGTCTGCCCTGCAGCAGATGGCCGAGGAGATCCTGTA
CCTCCTCATCGAGGTGTACCGGGCCACAACGGACATCTGGGTCGACTGCCTGGTGCGCGAAAACTATTCGGCCGTTGCCG
TGGACTATGCCGTCGAGAACAGCCTACACGCGCTCAAGGCCATTCGCCACCTGGTCGTCAACGGCTTCGACAACCCGGCC
CACTCGCCGCTCGTCCAGCAGTTCTGGGGGCTGTCGCACTCCAACTTCGAATCGTTCATCAGCTACATACACCCGGAAAC
GGACACTCCACCACCACACCAGGAGGTCATTGGCAGGCACATCTTGCAGCTCGCCAAGCTGCACATTGCCGTGTGCGACG
CCCACCCGGCCAGCTTTGCCCTCCTGCCCAACTCGGTCGTGCTCGTGCACGTCTACTGGGACCTGGTCTCGAGCTTTGCC
AACATGTACACGTCGTCGGCCGGTCTCCGGCCAGGCGGCGGCAGCGCGCGCATGGCCAAACCGAAAGTGGAGGGCCCTTT
CTTTGAGCAGCTTGCGCTCAAAGGTCTGCTGCTGCTGAAGAGCTGTCACCAGATCATCAGCCGGCCCATGGTCGCGTTTA
AGAACCGCGACGAGCAGACGCGGCGAGAGCAGGCTCAAGGCAAGCAGATTATCGAGACACAGCTCTTCACCAGCGAATTC
ATGCTGGTCGTTGTGGACGTGATTGTCAGCAAGCTCTTCGTCTTCCGCCAGTCGGATCTGGCCGCCTGGGACGAGGACCC
GGAAGAATGGGAGGCGGAAGAAAGCGAGTCCGGCTCGGCGTGGGAATGGCAGGTCCGGCCCTGTGCTGAGAAGCTGTTTC
TGGGCCTGCTGATCAAGAACAAGAGCATGCTGGTGCAGCCGCTGCTGGCATACTTTGACCGAACGATGAATGGTTCGATG
GACCTGCTCACAAAGGAGGCCGTGTACACGGCCATGGGAAACGCCGCCGTGGCCATCGAGGGCATGTTTGACTTTGACAG
CTTTGTGGCGTCGACCCTGGTCCAGGACGCACAGTCACAGTTCGAGCTGGCCCGGGTGCTTCGGCGGCGCGTCGCCATGC
TCCTCTCGGCCTGGGCGTTTCACGAACTGAAGCCAGACGCCACGCGGGCGGTGTACTCGATCTCAGCCCACCTCCTGAAT
GCGAGCGACCCGGCCAACGACCTGGTGGTGCGGCTCACGGCGGCGCGGCAGATCAAGGCCACGGCCAACATCGCCTTCTC
GGCCGAGGCGTTTGACCCGTTCTCGACCGGCATCTTCTCGTCCCTGATGCAGCTCCTGCAGGAGGTGGAGAACGAGGAGA
CGAAGCTGGCGGTGCTGGACACGATTCGCGTACTCATCGAGCGGATGGAGACTACGGCAGCACGATTCAGCGACAGCGTG
GTGGCGGCGCTGCCGGCTGTGTGGGAGTCAGCCGGGCCGGAGACGTACATGATCAAGCAGTCGGTGCTGGCGATCATCTC
CAGCCTCGTGATGGCGCTGCAGGCGGCGTCACAGCGGTACCACGAGCTGATCCTGCCGCTGATTGCAGATGCGGTGAACC
CGAGCTCATCCGTGCACGAGCACCTGCTGGACGAGGGCCTGGACCTGTGGTGCAGCGTGATGACCATGTCGTCGTCGCCG
CTGTCGGAGAACCTGGTCGGCCTGCTGTTGAGGGTGGTGCCACTGCTAGAGTATGATTCGCCGGTGGTGGAGACGTGTTT
GCGGATCACGAATGCGTACATTGTGTTGGAGCCGTCGACAGCCCTGTCAGAGCAGTTCCGGAAGCCGGTACTGAACGGGC
TGGCCTGTGCAATGGAGACGACACGAACCGAACAGGTACAGGAGGCAGCGGCAGTGATGCGCCACCTGGTGCAGGAGGCG
CAGGTGCTGGGCGGCTCGGAGGGTGTGTCGTTGATCGTGCAGGACCTGCGGGAGACGGGCTTCCTGGAACGGATGCTAAA
ACGAATCCACGGAGCGTGGGAGGCACACCAGTCGACGGGGCCCAAGGCGAAGCAGAGCCCGATCGGACCGACGACGGAGA
TCCAATACTACAGCATTCTCGGCTGGGTAGCACTGGCAGATCCGAGGGTGTTTGTGCAGTCGATCCTGTGCTCGACGAAC
GATGCGGCCTCGGTCTGGAGCTGGCTGGGAGCAGAGTGGTTCGGCATCTTTGAGATGATGGGCAGCTCGGAGCACCTCAA
GCTGTCGTGTCTGGGGCTGACACGGCTGTGCGAACTGGCGGAGCCGATGCAGGGCCTGGTGCTGGGTCGGCTGCAGGACT
ACTTCTCGATGTGGACAAGCACGGTGGCGGACGCACAGGGCGACGCGACGCAGCCGGACTGCTACGTGTGGGATGGGCCG
CCGACGACAGAGTACGACACGCCGCTGCAGACGGCCGAGAACGCGCTGGCGGCCAAAGAGCCGGTGCACACGGAGCGGAC
CTTTGACTTTGTGCTGCTGCGGCTGCAGAGTTTGGTGGCACAGTGTGGCGGCGAGCAGCAGTTTGAGGCCGAATGGGCCG
TGAACGTGGACGTGGACGTGTTGGCGGGATTCCGGGAGTTGTCGCAGCCACGGAAGGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62