GenePrediction:GLEAN_2278 Details

Name: GLEAN_2278
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:171071..175406 (+ strand)
Length: 4336
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:171071..174252 (+ strand)
Length: 3182
Type: CDS
Source: GLEAN
Position: GCSC_140:174752..175406 (+ strand)
Length: 655
>GLEAN_2278 class=GenePrediction position=GCSC_140:171071..175406 (+ strand)
ATGCGACGGTCTCGGGGCGCGTCTCCGCCGTCGCCGTTCCGGGCGCTGGCCCATCATCATGCACAGCAGGCGGGTGGACG
GCGAGCCGAGTCGGTGTCGTCGATGCTGCGGTCGTTCAACGTGGAGACAAATCCGACACGACCGATGCGTCCGAGCCCGC
TGACGGCATCGACGATCCCGGACATGCCGCTGGACCTAGTGGACCGGATCCGGTCGTTTCCGCTCTTCATGTCGGCGCCG
GACGAGTTTCTGGCAGCCATTGGCAAGCACCTGCGGCCACAGGTCCACGGGCCCCACGACCACATCCTGACAGAGGGCGA
CGACGCCAAGGCCATGTACTGGCTAGTGCGCGGCGCGGTGGCGGTGACGTCGCGCGACAGCGAGGCGGTGTACGCGGAGC
TCAAGCCAGGGGCGTTCTTTGGCGAGATCGGCGTGCTGATGGACATTCCGCGGACGGCGACGATTGTGGCGCGGACAAAG
TGCCTGCTGGTGGTGCTAAAGAAGGAGGACCTGCAGGCCGAGCTGCCGCGCTTCCCGGACATGGAGAAAGCGATCCGGCA
GGAGGCACAGGAGCGGCTGACGATCCTGCAGAAGAAGCAGCAGGAGCGAAGGCAGGACGTCGGACCAGACGGCGGCCGAG
GAGGGGGAGGATCGAGCAGTGAGAGCGGCACGATCGGCGACGGGGCGATAACCAGCAACAGCAACAGCATCAGCATCACC
AACGGGATCACGAGCATTAGCATCAGCACCAACAGCAAGAACAGCAAGAAGCGCAAGTCGCCGAGCCCAGGGGTGATTGA
GGACCCAGCAGTCGGCGGCAGTGCTCTGGGCAGTGGCTATGTCAACGTGCGCAAGACGCTCAAGGAGCTGCCGCTCTTCT
CGACCCTTCCGGCCGACATCCTGCATTTTCTGGGGCTGAGCGCGCAGCCCAAGAGCTACTCGCCCTTCACCGACATCCTG
CGGCAGGGCAGTCGAGGCAATGACATCTTTTTCATAGTCAGCGGCGAGGCCGAGGTGGTGCACGAAGCGCCCAGGCCTGA
AGGCGAGGCCGAGGACACGGCGTCGTTTGCACGGCCACGACTGACGCAGGGACAGTACTTTGGCGAGGTGGCCAGCCTGG
GCCTGTCGCCAGGACGAGTGCGGACGGCGACGGTGCGGTCGATCACCAGCGTGGAGTGCCTGATGATCAGCGGCGAGGCG
CTGGACGAGCTGTGGAGACGCTGTCCGCCCGGACTGAAGCTGCAGGTGGAAGAGACGGCGCGGGAGAGATATCGGCAGAG
CCGGGTGGCAGCAGCAGGAGAGGCCACATCGGACGATGCAGACGTCGAGATGAGCGACCGGCGAGAAGGTGGAGAACAGA
TGTCGGCCATCGGCAGCAACAGCAACCGGGAAGAGGTCTTGTCTCTACGACGACCTTCGGTGCCTCACGTGACTTTTACA
ACGCCGTCCAAGCCATCCTCGCCGACGACAGACGAGGCAGACATGCGACAGCCGAGCGACCCGGACCCGTTTCTGAGCGT
GGACATGGAGAACCTGCGGAACCGACGGAGGAACTCGCTGGCACCACCGCTGCCGGCGGGAGACTCGTCGTCGGGCGGGC
AGACGACGCCGTCGCCACAGATAGAGAACAACAGCAGTCCGCTGAAGCTGTTTACGTTTCCGCCTCTGACAGCCGCCGAG
GAGCCGACAGCAGCAGAGCCCGAGGAAGAGCGCAGTTCGCGAGGACGGTTCAAGAAGGCACGGACGCTGGCCCACCGGCC
CTATTCAGACGAGCGAAGCGGATCGCCGGCTGAGGATCATGCCCGGAAACACGCCGAGGAACACGCCAAAGAGCAGGCCC
AGTCGTCGCCGCAGACACGGCAGCAGGGCCCGTCGGAGGCGGTGCTGGTGGGCGCGTTTCTGTACCTGGACATTGTGGAG
CTGATCCGGCTGCGGGCAGTCTGCCGGGAATGGCGACGGGTGCTGACGACGTCGCGACAGCTGTGTCGGCGGGTCGACCT
TGGCGGGCTCAACCGGGTGGTCAACGACTGGTCGCTGACGCAGGTGATTGCGCCGTTTGTGGGCCAGCGAGCAGAGGAAA
TCGACATCAGCAACTGTTTCCACGTGACCGACGAGGGATTCCAGGCGCTGTGGCGGCAGTGTGGCCACAACGTGCGGGTG
TGGCGCATGAAGTCGGTCTGGGACGTGTCGGCGAACCAGATCCTGGACATGAGCGAGAACGCCAAGGAGCTGGAGGAGCT
GGACTGGAGCAACTGCCGCAAGGTGGGCGACAACTTGCTGGCCCGGGTCGTCGGCTGGGTCGTTCCCGGGGAAGCAGAGG
GTCAATCGGGCCAGCCACAGGGTCAGCCACAGGGTCAGCCACAGGGTCAGCCACAATCTCAACCACCCAAACCAGCGCCC
GGAACGGTCATTGGCTGTCCACGACTGAGCGTGCTGGACCTGTCGTACTGCAAGCACATCACGGACCGGTCGATGATGCA
CCTGGCTGCACACGCGGCAGGACGGCTGCGGTCGCTGACGCTGACGCGCTGCACATCGGTGACGGACGGCGGGTTCCAAG
CGTGGGCGCCGTACCGGTTCCGACAGCTGACGCGGCTGTGTCTGGCCGACTGCACATATCTGTCGGACAATGCGATCGTG
TCACTGGTGAACGCGGCCAAGGCGCTGACCCACCTAGACCTGTCGTTTTGCTGTGCGCTGTCGGACACGGCCACCGAGGT
GGTGGCGCTCGGTCTGCCGTTGCTGCAGGACCTGCGGCTGGCCTTTTGCGGCAGTGCTGTCAGCGATGCGAGTCTGCGCT
GCGTTGCACTGCATCTCAACGATCTGCGCGGGCTCAGCGTGCGTGGTTGCGTGCGCGTCACCGGGACCGGGCTCGAGCAT
GTTCTCGACGGCTGCGCCCGGCTGCGTTGGCTTGATGCCAGTCAGTGCAAGAACCTGGCTCGCTGGCTGGCCGACGGCGG
AATTGCCCGTTGGGGCTTTGATGACCGTGTTGGAGGGGATGGGCCTGACGGAGGGGGCGAGCCCCGATCGTCTGTCACGT
CCTCTGAGCGCATCCCGTCCGGCTGGAGTCCGCCCGGTCTCGGCCTCGCTCCACCTCCGATGCCCTCCGTACGCGGCCAG
CGACGACGTGCCCGTCATCCGGTCCGCTTCATCGTCGAGAAGGGCGCCTTGGGCGGGCTGCGGTGAAAGTGGCGTGGCGT
GCTTTGGGTCTTGGTCTCGCTTGGTATTGGCTGTTCTGTTTTGGTGGCCGCCTCGTTGGTTCTGGCTGTCGCTCTGCTGT
CGCGTTACTTTCACCCTTGTTGCTTCTCAGAGCCTCGATACCCTATGGGTTTACGGAGTACTCCGTATCACAATACAATA
CAATGATTTTGGACATATGTGCTGACTAATCAACCCGACTTGAGTACCCGTCCCTGCCTAAACGACTTTTCGCTGACATT
AGCGAAAAGTCCTACTGGTACTTCCGCATCGCCGACAGAGAAACGGCCTCCAGGCAACAGGCAATGTTGAAGTCACCGAG
GACAGAGTATATGAACGAGCCACCTGGCTAATGTAGAGAAACGCAGCAGCAGGACAAAGAGAATTATAGCAGAAGCAGGA
GCAGAGCAGAAGCAGAAGCAGAAGCAGAAGCAGAAGCAGCAACACATCCATCTCCCTCGATATCATGACATTGTCCGACA
GTGTGGCCGATCGTGTGTATCGCGTGGGCATCATCTGCGGCTCGCAGCGTGCAGTGCGTGCAGGTCCGCAGGTTGCCGAC
TTTGTGGCCGACGTGATCGAGGCGAAGCTGGGCTCGACCAGCGCGATCTCGGCCGACCCGTCTGCTGGCCTTTCGGCACC
GCACATCTGCCTTGACCGGATCGACGTGGCGGCGCTGCAGCTGCCCCTGACGGACGAGCCGGGCGTGCCGTCGCAGATCC
GGACGGCCGACGAGTATGCGTGCGAGCACACGCGGACGTGGTCGCGCCGGGTGGCGGCGCTGGACGCCGTCGTCTTTGTG
ACGCCGCAGTACAACTGGGGCGTGCCGGCAGGCCTGAAGAACGCCATCGACCATCTCTTCCACGAATGGACAGGCAAGCC
GGCCCTGGTCGTGGCCTACGGCGGCCACGGCGGCGACAAGGCCGCTGTCGCTCTCGCCATGGTGCTCGCCGGACTGCACA
TGCGGCCGGTTGAGAAAGCGGTGCTGCTGGCGTTTCCCGACCGACAGACGACGGAACGGGCTGCCGGCGGAATGGATCTC
GGACTGGCCGGGGATCATGACAAAAACGCGCTTTGGTTCGACCGTCGAGAAGACTTGGTTACGGCCTGGACTAAGCTGGT
GGCCCTGATGGTCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62