GenePrediction:GLEAN_2282 Details

Name: GLEAN_2282
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:212071..213793 (+ strand)
Length: 1723
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:212071..212167 (+ strand)
Length: 97
Type: CDS
Source: GLEAN
Position: GCSC_140:212235..212303 (+ strand)
Length: 69
Type: CDS
Source: GLEAN
Position: GCSC_140:212368..213023 (+ strand)
Length: 656
Type: CDS
Source: GLEAN
Position: GCSC_140:213092..213793 (+ strand)
Length: 702
>GLEAN_2282 class=GenePrediction position=GCSC_140:212071..213793 (+ strand)
ATGAAGCTCAACGCGGCCACCACGCTTCCCTTCCTGGCCTCTTCCCTCCTGGTTCGGCAAGCCTCAGCCGCACTTGACGT
CGACTTGACCTCTTCCGGTGCGTTCAGCTCGTTTCGAGTCCGCTCAGCTCGGTCTGGCTTCTCAATGCTGATTGTCGCTT
CTAGACTCCATCAAGCAGGCTGCCAAGCTCGTGGCGGCGAATCTGTTCACGTACTACAAGGGCAACCAGTATGGTAAGAT
CGGAGGCAACCCCGGACGCGCGCACCGGTAATTGAACACCAACGCTGATCCTCGCAGGCCAGACACCCGGCATCCTTCCC
GGCCCGCCGCCCTTTGGGGCCTACTACTGGTGGGAAGCCGGCGCCCTTTGGGGCACCTACATCGACTACTGGCACTATAC
CGAGGACGACACGTACAGCAATGTGAGCATGAACTCGTTGTTGTTTCAGGCCGGTGCACCCGGCAACAGCTTCCAGCCGG
CCAATGTCACCATGTCCCTCGGCAACGACGACCAGGGATTCTGGGGCATGTCGGCCATTCTGGCGGCCGAGACCGTCTTC
CAAAACCCACCTTCGAGCAAACCGCAGTGGCTGGCCCTGGCCCAGGCCGTCTTCAACACGCAGGCCGCTCCCGACCGCCA
CGACGGCACGTGTGGCGGCGGCCTACGCTGGCAGATTCCCTTTGCCAACACTGGCTACGACTACAAAAACTCCATCGCCA
ACGGCATCTTCTTCAACCTTGGTGCCCGTCTGGCGCGCTACACTGGCAACGATTCATATGCGCAGACGGCCACTGAGACC
TGGGACTGGGTGCAGGGTGTCGGCCTAATGTCGGCCGAGTACGACATCTACGACGGCGGACACGTCGAGAAGAACTGCAC
CGACATCTCCAAGGCGCAGTTTAGCTACAATGCCGCCGTCTTCCTGGAGGGAGCGGCCTTTATGTACAACTATGTAAGTG
CAGGGACAGACAAGAGAAAAAGAGGAAAAAGGAAAAAGAGAAACAAACTAACATTCACCAGACAAATGGCTCCGATATCT
GGCGCGAACGCGTCGAGGGTCTCGTTAATCGCACGCTCGATATCTTCTTTCCCAACGGCATTGCCGTCGAGCTCAGCTGC
GAGCTGGCTGAACGGGTGCAGTGCAACACCGACATGCTCTCGTTCAAAGGCTTTCTCCACCGCTGGCTAGCCACGGCCAC
GAAGATGGCACCCTTCACCCACGACACAATCATGGCGGTCTTGCGCACCAGTGCAGCCGGAGCCGCCCAGGCCTGCGACA
GCTCGGGTGTGTGCGGCTTCCGCTGGACCACCGGCTCCTTCGACAACCTCACTGGTGCCGGCCAGCAAATGAGCGCCTTG
GCAGCACTCTCTACCCTCCTCATTAACGAGCCTTGGGCCATTGCGCCGGCCACCAACAGCTCCGGTGGCACCAGCCAGGG
CAACAGTGCGGCCGGTACCTCCTCGCCAACTATTGAGACCTACAGGCCTCTCACTACCGGCGACCGTGCCGGCGCCAGCA
TCCTCACCATCGTCATCCTCGCCAGCCTCGTCGCCCTCTACTTCTGGCTCTCGACTGACCTGTCGGAGAACAGTGGCAAC
TGGTGGCTGGAGCTTGAGTCGACTCCGCTGGGTGCGATGCTGCTGCGGACAAAGCCAAAGCAGGACTTGACGAAACAACT
ATCGGTAGCTTCAGCCACCTCGGCCTCGACATCCGCGGCTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62