GenePrediction:GLEAN_2284 Details

Name: GLEAN_2284
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:220770..221782 (+ strand)
Length: 1013
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:220770..220783 (+ strand)
Length: 14
Type: CDS
Source: GLEAN
Position: GCSC_140:221098..221145 (+ strand)
Length: 48
Type: CDS
Source: GLEAN
Position: GCSC_140:221299..221545 (+ strand)
Length: 247
Type: CDS
Source: GLEAN
Position: GCSC_140:221607..221684 (+ strand)
Length: 78
Type: CDS
Source: GLEAN
Position: GCSC_140:221750..221782 (+ strand)
Length: 33
>GLEAN_2284 class=GenePrediction position=GCSC_140:220770..221782 (+ strand)
ATGGCCAAGCTCTCGTAAGTCGAGGATTCCTTCCGGATTAGTCTGCCTTTCAGGGAGATATTTGCACCAGGTTGTCGGGC
CGGAGGAACACCAATGCGAGGATGGAGCTGGGGATGAAAAAGAGAAGAAAAAAGAGAAGCAGAGAAGAGGAGGGCAACAG
ACGAATTTGGATGGGAACGGGGCGAAGTCTGGACGAGTTCCTTCGAATGAATCGTTGAAGATCGGGCCGTCTGACAATCT
GGGCGCAAATTGGTCGAACACATTGTCATCTCGTGAAGGGCAGACGACGTTTCCACGACGAGCCCCCATGCTGACATATT
TTCTCTAGTCGCGGTGCCCCCGGTGGCAAGCTCAAGATGACCCTGGGTCTTCCTGTGTATGTTACCATTTTACCTATTGT
GATTTTTCCGTTTTCTCTCGTCTCCTCGGATCGACCGAACGAGGGAACATCCGACGAATGAAGCAAGGATCGAACGACTC
CGACCGGGAGAACCAGCGCGACAGAATGGAATGCTAACAGCGATTACAGTGGTGCGATCATGAACTGCGCAGACAACTCT
GGCGCTCGCAACCTGTACATCATCGCCGTCAAGGGTATCGGTGCCCGCCTGAACAGACTACCTGCCGGTGGTGTGGGCGA
CATGGTGATGGCCACGGTCAAGAAGGGCAAGCCGGAGCTGCGCAAGAAGGTGCACCCGGCCGTCATTGTGCGCCAGTCCA
AGCCGTGGAAGCGCACCGACGGCGTCTTCCTGTACTTTGAGGACAACGCTGGCGTGGTATGTTTGGAGGATCTGCTCTCG
CTGAAGGGATCGCGTGGTCTTGCTGACAGTTGTGCAGATTGTCAACCCCAAGGGCGAGATGAAGGGCTCTGCCATCACTG
GCCCCGTCGGCAAGGAGGCTGCCGAGCTCTGGCCGGTACGATATATGTCCCTGTTTCTCTTCTTCCTGTCTACTCTTTCC
TCCCTGCTGACCAGCTCCAGCGTATTGCCAGCAACTCCGGTGTCGTCATGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62