GenePrediction:GLEAN_2285 Details

Name: GLEAN_2285
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:228884..230639 (+ strand)
Length: 1756
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:228884..229463 (+ strand)
Length: 580
Type: CDS
Source: GLEAN
Position: GCSC_140:229513..230077 (+ strand)
Length: 565
Type: CDS
Source: GLEAN
Position: GCSC_140:230231..230639 (+ strand)
Length: 409
>GLEAN_2285 class=GenePrediction position=GCSC_140:228884..230639 (+ strand)
ATGGCCAGCAAACGATCAAAGAACGCCCCTCCTGCCGACGATCTCGACGAGCTCTTCGAGGGTATCGGCGACGAGACTAC
CGCTCCCAAAAAGACCACAAAGACAAAGGGCCCGGTCGGAGCCAAGAAGACCGGCCCAGGTGGCCCTGGCAAGGACATAC
TCGCCGAGCTGGAAAACGAGCTCGAGGACAAGCCGATCTCACGCCCGCACACGCCCCGCATCAAGGAGATTGCCGCCTCC
TCGACCTCGAGAGCCTCGCCCGCTCGTCGTGCTGCTGCCGGGACGCCGCCTCCGGATGCCGCCTCGCTTCCCCGTCGGTC
TGCCGACAGCGCAAAGTCTGCTCTGGCTGCCGAGGTCGTACATGATCACGCACCAGAGCTGATGTCTACATCGGCATCGG
CACCAACAGCAGCACCTGCTGCTGGCGGCGGCGGCTCCGGCTGGTGGGGTGGTCTGCTCTCGACCGCTTCAGCAGCCATG
AAGCAGGCCGAGGCTGCTGTTAAGGAAATCCAGCAGAACGAGGAGGCCAAGAAGTGGGCCGAACAAGTCCGCGGAAACTA
CTCTGCTCTTCGCGGCTATGGTGGGTTTCGTCTTGCCCTTCTTTCGCCTCCCTCTCACTGACATCTCAGGCGATGAACTT
CGCCATCGCGCACTGCCGACTTTCACCGACATTCTCCACACTCTGGCACCACCAATTGCCTCACACGAGCGGCTGCTCAT
CCACATCACCCACGATATGGTCGGCTACCCGTCGCTCGACCCGCTCGTCCACGGCGCCTTCTCGCGCGTCATGGCCCAGG
TCGAGGGCGGTGATCTGATGGTCATCCAGCGCGGGCAAGAGAGCGCTGTGCGCACGTCGTCTTCAGCGTCGGAGCGAAAC
CCGGGGTCCACAGGCAACGGCACGGCTGGCTGGCGCGATGGGCCCTGGTGGCGTGCTGTCGACAGCCCTCGTGATCTCGG
GGCCGTGCCAGGACTGCATGAGGGCACGAAGCTGTGCCGCGCCAGTGCTGAGGCCTATGCTAAGGAGTACCATGCGGCCA
CTGGCGGCCTGGATGAGGCTCGTCACCGCGCCGTGGAGCCCATGTCCGAGAGCAACCCGGTCCGGCGCTCCGACTTATTC
CTGGCCGTGCAGGCCATCCTCACGACTGCGGCTGCTGCCGGCAGCGACAGCAACACAGAGCCGCTCTTTTCCGGGTCCCC
GGCAGCAGCAGCAGCAGCAAAGAAGGCCAAGGCAGCCAGCAAGAAGCACGAAGAAGACGAAGACGACGAAGACAGTGATG
ACGAAGACGAAGATGAGGATGAGGACGAGGACGACGAGGTCGGCGACGGAGCGGAGGAAATGGTCAGCTTTGCGGTCTAC
GTGCTGGACCCGGTGCACGAGATTGTCTTCTCGACCGTCAGCCAGGAATTTCCGTCCAAGTGGACACGCTGGCTGGAGGC
GCCGGCAGCGTTGACGCCCGCCAGCAGCAGCGTCGACGATGGGACAGCGGCAGCGACGGCGGTGTCGGGAGGCGACGACT
ACGAGCGTGTGCCCGAGGACATCCGTGCCATTATTGAGAGTGGTGGCGTCGATCCGCGCGAGTGGGTGGCCGAGTGGGTC
GAAGAGGCGCTCACGCTGGCCGTCGGCGTTGTGGCCCAGCGCTATGTCGCACGCCGGATGGGTGTCGGTTTGGGCAGCAT
TGGCAAGGGTAAGCGGCGCATGGACGCCGTTATTGCAGATGGTGGCGGCGAGGCTGCACGAGCCGGCCTGATCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62