GenePrediction:GLEAN_2286 Details

Name: GLEAN_2286
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:235811..239540 (+ strand)
Length: 3730
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:235811..235893 (+ strand)
Length: 83
Type: CDS
Source: GLEAN
Position: GCSC_140:235957..236076 (+ strand)
Length: 120
Type: CDS
Source: GLEAN
Position: GCSC_140:236132..239540 (+ strand)
Length: 3409
>GLEAN_2286 class=GenePrediction position=GCSC_140:235811..239540 (+ strand)
ATGCCGCCGACAGACGCGGGCGCGTCGTCCATTGCGGTGACGGTTCGTGTGCGGCCATTCACAATTCGAGAAGCAGCCCA
ACTGTAAGCTATCTGCAGCAGACGGAAAGGTAACTGGCACGGATGGCTGACCGGATCGGACGACAGACAAAAGACAGATG
GGGGCACGCTCTTCCTCGGAGACGGCTCGATGGCGGCGGCTCCCACGCCGAAGCTGAACCAGAAAGGACTGCGGTCGGTG
ATCAAGGTCGTTGACGACCGCTGCTTGTAAGATGCCCTCGCTTTTTGTGCGTTCTTCTGGGTTCCCTTCTAAGACAGGCA
GGGTTTTCGATCCACCGGAAGACAACCCGGTGCACAAGTTCTCTCGATCGGTGGTGCCGACGGGCAAGAAGGTCAAGGAC
CAGGTGTTTGCGTTTGACCGGATCTTCGACGACAACGCAACGCAGGCGGACGTGTACGAGGGAACGACCAAGGGCCTACT
GGACTGCGTGCTGGACGGATACAACGCAACGGTGTTTGCATACGGAGCGACGGGCTGCGGCAAGACACACACGATCACGG
GAACGGCGCAGCATCCGGGAATTATATTTCTGACGATGCAGGAGCTGTTTGAGAAGATGGACGAGCGCAGCGGGGAGAAG
GTGACAGAGGTGACACTGTCATACCTGGAGATCTACAACGAGACGATCCGTGACCTGCTGGTTCCGGGAGGCAGCAAGCA
GGGGCTGATGCTGCGGGAGGACTCGAACCACGCGGTGACGGTGGCGGGGCTGAGCAGCCACCGGCCGAACAACGTGCAGG
ACGTGATGGACATGATTGTGCAGGGCAATGAGTGCCGGACGGTGTCGCCGACGGAGGCGAACGCGGTATCGTCACGGTCG
CACGCGGTGCTGCAGATCAACGTGTCGCAGAAGGATCGCAACGCGAGCGTGAATGAGCCGCACACGATGGCGACGCTGAG
CATCATCGACCTGGCGGGCAGCGAGCGGGCGAGCGCGACGAAGAACCGTGGAGACCGGCTACTGGAGGGAGCCAACATCA
ACAAGTCGCTGCTGGCACTGGGAGGCTGCATCAACGCGCTGTGCGATGCGCGCAAGACGAATCACGTGCCGTACCGAAAC
AGCAAGCTGACGCGGCTACTCAAGTTCTCGCTGGGCGGCAACTGCAAGACGGTGATGATTGTGTGCGTGAGCCCGTCGAG
CGCGCACTTTGACGAGACGCAAAATACGCTGCGGTACGCGAACCGGGCGAAGAACATACAGACCAAGGTGACGCGCAACG
TGTTTAACGTGAACCGACACGTCAAGGACTTTCTGGTCAAGATCGACGAGCAGATGGCGCTGATCAACGAGCTGAAGGCG
CAGCAGCGGGACGCGGAGCGGACGTATGCGACCAAGGCGCGGCGGCAGCTGGAGAAGCGCGACGTGACAGTGCGCGAGGG
CATGCAGCGGATCCGGCAGGCGTACGACAATGCGGCGGCGGAGCGGCAGCAAAAGGTGGCGGACATGTGGAAGCTGCGGT
GTATTGAGCGGCGGATCAGCACGCTGTCGGCGTGGATGATGGCGTTTGAGATGGTGGAGAGTGGTGGTGGTGGTGAGGTT
GGAGAGGATGGAGAGGCTAGAGAGGAAGCAGGACCTACAAGGATGGCAGCAGCACTGGTGCCGATGCACAAGTCAGCACG
GGGAATCCTGGCGGAGCTGGAGCACAGCCGACAACACCTGCACCAGAAGGTGGAGCGGTGCAACTGGGAGCGGGCAGTGG
ACACGGCGCTGCAGCACAGCATTGGACAGGTGAAGACAGCGGTGGCAGACAGCGCAGTAGCGGATGCAGGCGAGGCGATT
GCGACGCTGACACGCGAGGCAGAGCTGCTGAAGGCGCAGTTTGGGCGCGAAGCGTTGGTGGAGGTGCAGGAGCAGGAGCG
GAAGACGGGGACAGGCGAAGTGATGCAGGGACTGCTGGCGGCACAATTCCGGATGATGGCCGCACTGGCCGAGACGCTGG
AGATGGGCGACGAGGAAGCAGGCGAGCGTGGACCGACGGTGATGCAGGAGCTGCTGGAGAAGGGAGTGACAGCGGCAGGA
CAGGTGATCCGGCCAGACGTGTCGGCAGAGATGGCGGCGACGATTCCGCTGCCGAAACGCGGACAGCCACGACGCAAGCG
AATGTCTAGCCTGGGCTACGGAGGCTATTCGTCGACAGCACGGCCTTCTATTGGCGGGTCGTCGTATCTGGGATCGCATC
TGTTGGTGGCAGCAGCGGGGACGCGGCCGGGGTCGGGGTTGGGGCTGGCATCGCCGTCGAAGGCGGCACCTCGACGACAT
CGGGTCAGCGGAGCGGGAGCGCGTAAGAGCGTGTCGTTTACGCCGTTGAAGAAGAAGGCGTCGTCGTCGTCGCTGAAACG
CAGTGTGCGATGGCGAGACGACGCGTCGGAAGACGGCACGCTGGCCGACTACGAAAAGACGCCGCAGGGGGAGAGAAGAG
AGGGAGAGGGCGTGAGAGCCGAGAGTAGGGCGAGCGAAGCGAGGAGTGAAGAGAGCCAAGAGAGCCAAGAAGAGGCGAGC
GGAGCGAGGAGACAACTGGCTTGGACGATGGATACGGTGCCGGAAGAGGCGTCCAGTCCGATGAGAAGGGCGATACCCGG
CTCACCGGCATCTCCAGCACTACCGACACCACCATCGCTCAGCCGGATGGACCTGTTGGCAGCAGATGAGTCGCTGTTGG
TGGGCGACACGTCGTCGATGTCGACTTCGATGCTGGCCAGCAAGCCGAGCCGATTCCAAGCGGGATTTCTGACAAAGACG
CGGCTATCGTCGGCAGTATCGGCGCCATCCGTGACATCCATCCCATCGGCCGTTTCGTCCTCCAGTCTCAGTCCGCCGTC
ACCCGACAGCGAGCGGACGTTGACGCTGGCACCTTTACAGCGACGGGCGTCACCGCTGCGCAACATCTCGCTGCCGCGGG
CGGCGAATCACCAGCTGACACCGCCGTCAGCGACGCGGATTGCGAGCCTGAATCTGAGTGGCAGTCCCAAGTATATCAGC
ACAGGCTTGTCACCGTCGTCGTTGCGGGACGAGAACCAGCCGCCGAGTCAGCTGCCGCGGACGTCGTCGCCACGAACGTC
ATCGCCGGCCGGCCACCATTCGGACGCGGACATGACAGCTGGACTGACGGCTGGCGAGCTGATCGACCCGCTAAAGCTGC
GGTCGGCCATTCCAGCGGCAGCAGGCGCGCGGCTCTTCTCGATCGGCACCCATAACGCGCACAGCCGGCGGACGTCATCG
TCGCTGCCAGCATCGTCGGCGAGCTCGACTAACGGCATCTCGCGCCAGCGACGGCGCAGCAACGAGCGCCAGCGATCGCC
ACCCATTTCGTGCTCGCCGCCTAGGAGTCACGGCGCCGGAACGAGTGGCATTGGCCGGCTTGGCAGTAGTCTCAGCGGCA
GTGGCAGCGGCAGCCTGCGCGACGGCATGGCCACGCGTGGCGGTCTTGCGGGTCCGTCCGGTCTGTCGGGTGCTTCAGGT
CTCTCAGGTCCGTCCGGTCTGTCGCCCACACGCATCCGTCATGTTGCCACGATCAGCGGCGGCGGCTCACCTCAACAAGG
CAGCCGTCTGCTGGATGGCACCGGCAGGCGACGGACTACGACCGGCAACAGCGGACTGACCGGACCCGTGGTCGGGAAGA
AGGAGGGTAGCGGCAGCAGCAGCGGCAGCGGCAGTATGTCATGGCGATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62