GenePrediction:GLEAN_2288 Details

Name: GLEAN_2288
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:256633..260020 (+ strand)
Length: 3388
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:256633..256678 (+ strand)
Length: 46
Type: CDS
Source: GLEAN
Position: GCSC_140:256734..257543 (+ strand)
Length: 810
Type: CDS
Source: GLEAN
Position: GCSC_140:257601..260020 (+ strand)
Length: 2420
>GLEAN_2288 class=GenePrediction position=GCSC_140:256633..260020 (+ strand)
ATGTGGTGTATCAAGATCTTGCGAAAAAAGCGCGGCACAGGTCCAGGTAAGCACTTCGGCCCTTCCCATTGATAACAACA
CCAGTCTCAAACATGTGCCAGAACTCCCTTTCCCCGATGGCGTGAAGGTTCTTCATGACTGCCCCGACGCCGCGGTTGAC
ATTTGCTTTGTCCACGGCCTGACCGGTAATCGAGAAAGCACCTGGACCGCCAAAGGTCAGACCAAGCCTTGGCCAAAAAC
CCTCCTCCCACAAACGCTTAGCGATGCCCGCATATTGACGTACGGCTACGATGCGTACGTGGTTCGAGCGGGAGTTGCGG
GGTCGAATCGGCTGATCGATCATGCGATAAACCTTCTGCACGACTTGGTTGCAGAACGGGCCAGTTGCGGTGCATCAAGT
CGCCCTCTCATCTTTGTCGCCCACAGCCTGGGCGGCCTTGTCTGCAAGTTGGCCATCCTTCGCTCGCGAAACAATGCCGA
AGATCACCTTCATGGAGTCTTCGACTGTGTCAAAGGTGTTGTATTTATGGGAACACCTCATCGGGGCGCTTGGATGGCCG
ATTGGGCCAAGATACCTGTTTCTGCTTTGGCTGTTGGGAAAACTGCAAACACGAAGCTCTTGGACATTTTACAGAGAGAC
AACCAACTACTCGAGTCTATACAAAGTGATTTTGTCGGCATGGTACGGGAGCTACAGCAAAGCGGCAGGAGATTTGAGGT
TGTATGCTTTTTCGAAGAAATACCTCTGCCCGTTTTCGGTAAAGTCGTGTCTAAGGATTCGGCTACTTTTGATGGCTATG
ACCCGATTACCATCCACGCCAACCATATGGACATGGTTCGGTTTGCCTCGGCGGAAGAGAATGGCTTCAAGAGATTGAAT
GGAGAGTTGACAAGATGGAAAGGGCAGATTGGTAAGGAAAATTAGGACTTGTTTGTTACTAGGAACCTATACCAACTGCA
AGAAACAGATTCGTCCAAGCCAGCACCACAGCTGTCGGAAATCGAATCTCGCTGCCTAAAGTCACTAGCGTTTCCAGCGA
TGCATGATCGCTCCAATGACATTGACCGCGCTGCCGGTGGAACTTGCGAGTGGCTGCTTCAGCATGAGCAGTACACAAGC
TGGGCGTCTCGCGACCAGGGCTTGATGTGGATCAAGGGAAAGCCGGGCTCTGGGAAGTCGACTCTGCTCAAACATGCTCT
TGGCAATCAACGAATTCTTTCTAGCGCCAAGAAAGACGATCTGGTGCTGTCTTTCTTCTTCCACGATCGTGGTGACAGCC
TCCAAAGGACTCCCCTCGGCTTTTCCCGATCTCTCATCCACCAGGTCCTCAGCCAGTCTCCCGTTGCCCTTTCAGATTTA
ATCAAAACATTCAAGAGAAAATGCGTGGAGATAGGCGAGCCTGGCAACAAGTGGGATTGGCATCAAGGAGAACTGCAGCG
CTGTTTTGAGTCGTCTATTTCAGCTGTTCTGAAGGAACGCTCGGTTTGGCTATTTGTCGATGCCTTGGATGAATGCGGCA
GAGACAGCGCGGTCGAGCTCTTCCAGTGGTTCAAATCATTGCTTCAGACCCTTCCTCAAACGCTGCGTTTTCACATCTGC
GTTACCTGCCGCCACTACCCGATCATAGGCCAGACTTGCGACTTTGAGATATGCCCAGAGAAGGAAAACCACAAGGACAT
TTCCTTGTATGTGCGAACCCAGCTGTCTGGGGCGCGTGAGTTGGCCGAATCGTCGATTCCGTCCCTGCTCACCAACGCGG
CCTCCGGCGTGTTCATGTGGGCCCGTCTTGTTGTAAAGCAAATCCTGGACCTTGACAATGAGGGGAAGGGACTAGAGGAG
ATCAAGCAACGGATCAGCGACATCCCTCCGGAACTAGGTGCTTTATACCGCAAGCTCGTCGAAGACATGCAAGAGAAGCA
GGCTTCACTAAAGCTGATCCAATGGGTCCTCTTTGCGACGAGGCCGCTGAAATTGAAGGAGTTACGATGGGCTATGGCAA
TCGAACCTGGTAGTCCACAACGATCACTGGAAGAATACCAAAAGAGCAAAGAGTTCGTCACTAGCAGCGACAGAATGAAA
CGGCGATTAGAAGCGCTAAGCTGTGGGCTTGTTGAGGCTATTGCGTCATTTGGCAATGATGAAGACGAATATGACTCAGA
TGACTCAGACTGTTTTATCTCAGGCGCAAACTCGCCACTTGACGTCCAAAACGTCCAGTTTATCCACCAGTCCGTCAAAG
ACTTCTTCATGGACAATGGCCTATTAGCCCTAGACGACAGCTCGGCATCGTATAAGGCAGCAACCGGAAAGTCGCACTAT
CAGTTATCTCGGACCTGCTTACGCTATTTGATGACAGAGGAGATCGAACAATCAAAGGGCTTTAAGAAAGACGTGTTGAT
CGCCGACTTTCCTCTGCTGAAGTATGCCATTAAATCATGGCTGGTGCACACAAAGAGAAGCGAAGATCAAGGTGTTCCTC
AAGATGATCTTCTGGAATTGACTGCTTGGCCATCAAACAGTTTCACGGCGTTATGGAGGCTATTAGACGGCAAGCTAGAA
TTCGGAAATTATTATGCAACAGAAGGTACAGGTGCGACTACTCTCGTACACGTTGCAGCGATATACGATATAACAGGACT
TTTGTCTTCCATTCTGCAAAAAACCAACCAGTCCACTCTCGTCGATTCAAAGGACAATAATAGCCGGACGCCACTGTTGT
GGGCCGCTTGGGGAGGGCACGAGGCTGTAGTAAGGCTACTACTTGCTACTGGCCAAGTTAACACGAATTCGAAGGATGAT
AGTGGCCGGACGCCACTGTCGAGGGCCGCTTGGGGAGGGCACGAGGCCGTAGTAAGGCTACTACTTGCTACTGGCCAAGT
CGACACGGATTCGAAGGATGATAGTAGCTGGACGCCACTGTTAAGGGCTGCCATTAAAGGGCACAAGGCCGTAGTAAGGC
TACTACTTGCTACTGGCCAAGTTGACACGAATTCGAAGGATAAAGAGGGCCGGACGCCACTGTTGTGGGCTGCCGAGGAA
GGGCATGAGGCTGTAGTAAGGCTACTACTTGCTACTGGCCAAGTCAACACGGATTCGAAGGATAATAATGGCCGGACGCC
ACTGTTGAGGGCCGCTTGGGGAGGGCACGAGGCCATAGTAAGGCTACTACTTGCTACTGGCCAAGTTGACACGAATTCAA
AGGATGATAGTGGCCAGACGCCACTGTCGAGGGCCGCCGGGGAAGGGCACGAGGCCGTAGTAAGGCTACTACTTGCTACT
GGCCAAGTCGACACGGATTCGAAGGATAATAATGGCCGGACGCCACTGTCGTGGGCCGCCAGAAGAGGGCACAATCGGAT
TGTAGAGATATTATCTAAGATGGCTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62