GenePrediction:GLEAN_2289 Details

Name: GLEAN_2289
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:268255..269752 (+ strand)
Length: 1498
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:268255..268320 (+ strand)
Length: 66
Type: CDS
Source: GLEAN
Position: GCSC_140:268913..268953 (+ strand)
Length: 41
Type: CDS
Source: GLEAN
Position: GCSC_140:269013..269530 (+ strand)
Length: 518
Type: CDS
Source: GLEAN
Position: GCSC_140:269601..269752 (+ strand)
Length: 152
>GLEAN_2289 class=GenePrediction position=GCSC_140:268255..269752 (+ strand)
ATGGCACCGGCCAGCCATACTAATGCTGCTACTATAGACGAGCCACTACTAGCGGCCGAAGGCGGTGTATGTGTAGAGAA
ATTGATGGAATAAGAACAAGGGCTAAGCTTCTTTTTTTTAGGTAGACAACTTGGATGGAGATGCTGATTCAGCTTTCGGA
GACGAATATTCGTAAGTGTAATCTCTTCATCGCTGCATAATCTCAAACTCGCTCTCCGTAGTTTCATTTCGCCTTCCAGC
CATACGTGCTTTTTTTACTATCAGCGGGCGGCCGAAGCCCTCCTACCTTTCATAACACGTTTATCACCAAGCTAACACGT
CTTTAGACTTTCGACGGCATCTGTGACCAGCAGCATCTTACAGTACCGTACAATCCATGGACGGACCTTCCATAGCGACA
AATACGCAAGCTTTTTTTTGCCAAACGATGGCCAGCAACAGGAGGCAATGGATATAATGTATGTTGTACCCATATACGCC
CTTTCTTTCTTTACTATATCTTCCAACGGTTGACGTATACGGAATAGAAACCATGTCTTGACCCTACTACTAGACGGCGC
TTTTTTCTTAGCGCCTGTTCCAGAGACGGTTAAAGTTCGTTCTTATAACGGATAATACTATTAACTTAAAGTAACCTAAT
CCCCTTACCGTTTACTAGAACATCCTTGACATCGGCACTGGTAGCGGCACCTGGGCAATGTAAGAAGGTCCCATTTTCGC
GCATTCAAAGGGCCTATTTCTAACCCTATGCTTTCTAGCGACGTTAGCGACCAGTTTCCAAATGCCCAGGTGATCGGTAC
TGACATTTCACCCACCCAATCATTGTGGGTGCCGCCCAACACTAGATTCGAAATCGATGACGCGACGCAACCATGGACCT
GGGATGAGAATACCTTTGACTTTATCCACGTCCGTTATATGCTAGGTGCTATCACGGACTGGGATGCGCTGTTTTCTCAA
GCATACCGCTGCTGCACGCCGGGCGGCTGGCTTGAGTCGTGTGAGGTTCACCCTGAGCACCAAAGTGATGATGGGACGAA
CGAGTTGGCTCCGGTCTTGAAGCAGTTCTGGCAGCTGTATGAAGAAGGCATGCCCAAGATAGGCCGAAAGTTCTTTGTTG
TCAGAGAGGGTACACAGCGCAAGGCCATGGAAAATGCAGGATTTACGAACATCACGGATAAGACCTTCAAGGTGCCGATG
GGCGGCTGGCCTGCCGACAAGAAGCTGGCCGAGATTGGGCAATATAATCTTCTAGCGTTGCTAAACGACCTTGAGGGTAT
GTTTCTTGTTCTCTCTTTCTACGAAATCTTGCCCCTTATTGGAGGTGTTCCTACTAACTGTTATAGGATATACTACCTAT
CTGTGGAACGAAGTTTTACAGTTAGGCAAGGCCGAGTACCAGGTCTTTCTTATGGAATTGCGCAAGGCCGTAAAAGACAA
GAGAATCCACACATATTACACTGTCCGCTACGTCTACGGGCAGAAACCGTATGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62