GenePrediction:GLEAN_2292 Details

Name: GLEAN_2292
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:280824..282314 (+ strand)
Length: 1491
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:280824..281062 (+ strand)
Length: 239
Type: CDS
Source: GLEAN
Position: GCSC_140:281134..281601 (+ strand)
Length: 468
Type: CDS
Source: GLEAN
Position: GCSC_140:281657..282314 (+ strand)
Length: 658
>GLEAN_2292 class=GenePrediction position=GCSC_140:280824..282314 (+ strand)
ATGGCTACAATCACTACTCGCACGGGTGTCGAGCTGGAAGACCAGTCCACGGCCGCCGGCCGGACCGGGGTGATGCAGCG
AGACGTCGGCACCAGCAGCGGCTCCGACCGCAGGTCGACACGGGGTGGTGCAAACGAGGACGATCCTGTGCTCGAGGCCT
CACGACTGGCCGATGCCACCGTTCCCGAAGGCGGTTATGGCTGGGTGGCCATTGCTGGCTGCGCCGTCATCACCTGGTGG
TTCGTCGGCACGAGCTACAGCTGGGGCATCTTGCAGGGTGCTCTCGCCAATGAGGGTCTCGCCAGCACAGCCACTCTGGC
TTTTGTCGGGTCGCTGCCAACGGCTCTCATACCTCGGCCCTGGCCATCGTCAATGCTCGCATCGTCCGCTGGCTCGGCAT
CCGGCGCACTGGTCTTCTAGGCGTCAGCTTGCTCGGCCTCGGCGAGATCGTCAGCGGCTCCGCTGTCCATAGCCTCGCTG
GCCTCTTTGTCACTGCTGGCATTGTCATGGGCCTCGGCATCAGCCTCTGCTTCACCACCGTCTCTGTCACGCCCGCTCAG
TACTTTAGCCGCCGCCGGGGACTCGCCAACGACATCGTCTTCGCCGGTGGCGGCCTTGGCGGTGCCGCCACCACCTACCT
CCTCCAGGTCCTCGTCCAGAAACACGGCCCTGCCTGGGCTTATCGCATCGTCGGCTTCCTCACTCTGGCCACCGGCTTAC
CTGCTGCCTGGGTCGTCAAGGAACGCACTCCCATCCGCACTACTGGCTTCGTCGACTGGTACGTCTCCTGTTCCACCTCT
ACCTCTTTCTACTTCTTCCTCTAACCTTGACAGGCGCCTCTTCCGAGACCCAAAGTTCCTCCTCATTTTCCTCACTGGCG
TCATCGCCACCTTTCCCCTCCTCGTCCCCCCTTTCTTCCTTCCCCTTTACAGCCGCTCCATTGGTCTCTCCTCCAGCACT
GGCGCCGCCCTACTCGCTGGCTACAACTTCGCCTCTGCTGTTGGCCGCATCCTCTGTGGCTTCTTCTGCGATAGGCTCGG
CCCCGTCAACACCCTCTTCTGCGCCCTGCTGCTCACTGCACTCAGCATGCTCGCTCTCTGGCCTGCTTCCACCACCCTCG
GCTCTCTCGCCGTTTTTGTCGTCATCAACGGCGCCGCAAACGGCGGCTACTTTGCCACCATGCCCACTGTTGTCGGAAAC
GTCTTCGGTTCCCAGAGAGTTGCCGTCGCCATGGGCATGGTCGTCACCGGCTGGGTCGGCGGATATCTGATGATAAGAAT
TCTCGGGACAGTCTGCTTTTCTTCATCACTGACCCTATTCCAGGGCGCCCCCATTGCCGGCTATCTGCTGCAGGCTTATG
GTGGTGCCGACTCTGGTCTCAAGGCTTTCCGGCCTGCCATGTTTTATGCCGGCTCTTTGTCCCTCGGGGCAGCAATATCT
GTGGCATTGATGCGGTTATACATAAGCAGGTCGCCATTCAGAAAACTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62