GenePrediction:GLEAN_2293 Details

Name: GLEAN_2293
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:290259..293114 (+ strand)
Length: 2856
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:290259..291158 (+ strand)
Length: 900
Type: CDS
Source: GLEAN
Position: GCSC_140:291230..291476 (+ strand)
Length: 247
Type: CDS
Source: GLEAN
Position: GCSC_140:292513..293114 (+ strand)
Length: 602
>GLEAN_2293 class=GenePrediction position=GCSC_140:290259..293114 (+ strand)
ATGGAAGACATATTGAACAAGATGGTGCTCCCACAGGCGAAGGAAGTGGGCGGTTGGTTCACCGAGCTTCTCTTCTTGCT
TCACATGAAGGAGAAGCCGGATACAAAGAACTCAAGAGACCAGGACAGCGATCAGGCCAGCGACCATGCGATTTTGCCAT
CCCACAAGTCGCGCCAGTACCGTTGGTCTCACGTACTCAGTTACTTGGCCGTCATGGGTGGTTTCGCCTTCGACAACAGT
CACGCTCCCGAGAAGATCCCGCTGCCCAATAAACGTGCGCGCGTCACGCTGACCACGACGGGCATCTTGTTTCTGGCCAA
GCTAGAGCCAGACCTGATACCCGACATATCGGAGGAGCAGATCCGCGACAAGAGCAAAACCAACCCGCTTGCCAAGATTC
TCACCTGCCTACAAGCCCTCTGGTTTTGTGCGCAGGTGCTGTCGCATCTAGGCCAGAACCTAGCCGTGACGCTGCTCGAG
CTTAACACATCTGCACACGCGCTGTGCGCGCTGTGCGTCTACTTCATGTGGTGGAACAAGCCACTCGACATTGTCGAGCC
CTTTTCGATTGATGTGCAGAGCGATCGTGCGGCCGCACTGTGCGCGATGTTCTGTTACAATTTCGAAGGCGGCTTTTACC
ATCTGTGCCGCTTCGAAGGGAAACCCTATCAGCAGCATGATTTATTGCAAGTACGAGGAAGGATCTGTCTGGACTTAGAC
GAGCTGCTGCAAAGTCCTGAGCAGCAGGAATCAGTGAACGAACAACATGTACACGACATTCAAGAACAGCCAGAATGGCG
GAATCTTAGGTACAAAAACGACGAAAAGCGACCTTACTTTTTCGACAAGGTCGAACTACGCGCACCGAACTGCAGCTCAC
TTGACTATCTCCTCAGATACGTAAGCATGCCGCGCAAGATAAAAACCGGACTCAGCATAGACACCGATCCGGACATCTTT
ATCCGTTCTAGGTTAATACAATCGATTTTGGATCTGCCGATGTTGGCAGAGGAAATCGACGATGGCCGGCTTACCTGCTA
CCGCTCTTCTTCACGATCAAGGAGCGCGATGTCAACTTACCGTACTACGATACACTGTACCACGCCACACTCGCCGTGAC
TAGCTGCGTCTATGGTGCCTGGCATCTGATTGCCTGGGGCGGTCCCTTTCGTGGACGTACCGAGATGGTACTGTGGAGAG
GCTCGGCCATCGGCCTGGGTGCGTCGGTAGTGGCAATTGCTGCACTCGTTCTTATACGATACATTATAAGTGTGAAAATG
GATCTTACCGACTATTTTTATCTGTTAGTAGCATTACCTCTTTACTCCCTATGTGTGCTATTTTTGGTCGCTTGCAGGTT
TTGTCTGGTCGTCGAGAGCTTTATCGGAATTATGTATCTTCCGCCGTCATGGTCGGCATACTTTCCGCACATCGGCTAGC
ATCCAGAAGTCGGAAAAAGCAGGCTGGAACTGGGGAGGGGTGCTGATCCGTTTTGGTTGTTGTTTTTCGTTCTTTCCAAG
GAAGATGCTGTCATTTAATATCAGTTGCAATTGCGAGAATTTGATGGCGTATTTCGGGTGGAAACAATATATATTAAAGC
GAGTTTCGTCTAAGCTGTAGAAGCTCATGCACGGTGGTACTGCATCTTGGCCTCCTTGTGCACGCACTTCTTACTGGACA
GGCAGAAACGGGGTAGGCTATGCAGACGTGGCTCTCTCCTGCCCTCTCAAAGCTCAACACCAATAGGACAAGGGAACGGT
CTTTGCACAGTCATCAATTTGCCAGTGAGGCTCCAAAAGCGCGCAGACTGGGCATCCTAATTCCTGCTTTTGTCTGGAGG
GATCAAACAATGTCCACGACTTATTTTCGGGTTCTCAATACTATCTTATCATTAGTGGGACCTGCACACAGTCAACGATC
GCAAGTTTACTGATCCTGTGAATACCCATCTTCGATTGTGCCAGCATGGCAGCAGTGCATACCATATCAGACGACTGGGA
GGAGGTCCCTGACGATGACACATTCTCTATGGTGTCAACCCCAAGTTCAGACCATGACACAGTTCTAGTTCCCCGGGCCC
AGAGAGAGTGCACAAATACCCCCCAACAGCATCGTGTGCACTCGCCCCAGGAGATTCCCACGTCGTCTGCCTTATCATCG
CCATCCACCCCAATGGGAACACCTCGTGCATTCCTTCCCATGGTTGAGGCTCACTCACGCAGCCATCCGGCTTTGTCTTC
TCTAAATTTCTTAGCCACTCCAACAGAACTGTCGCCACCTTATTTGGACATCGACACGGAGGCCTATATGAGTGCCAGCC
ATTTGGACGGACTCCTTGACAACAGAGGTGATGGCTCTAGTCATCTCGACAGCGCGCTTGCCGTCAACCGCGTTGGTGTC
GATACTTCAACGCACCTCTGCAGCCTGGCAATGGTCGAGTCAGCCCGTAGCGAGATCGTTCGCTTCACCACCAACGAGCT
GGCTCCTCTCCGCGCTCGCTTGGGCCAACAGATCCTGGAAGTATGCTTCAAGCTTGGCAAGCAGGTGGAATCCCTGCATG
CCATTCTATCAAGTTTTGAGAGTGACTGGGATCCTGAGAGCGCTGGCTCGTACTTCGACCCTGCCCTTGAGGAATGGCTG
CACTGTGTGAAGCAGGTTCTTGTGGCGATGCAAGCAGAAACCGAGTCCGTTGCTCTACATAGCTTGGACATGGACAAGGA
TACTCGTGACGATGTGGTGGACGGCAAAACCGAGGAGTTCCTGCAGTGCTTCTATGTGCGTTTGGTCGATCATACCGACA
AGATGGACGACTTTCTCCCTATTATGATTTTGTACGCAGCTCCTCCTTCAACCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62