GenePrediction:GLEAN_2294 Details

Name: GLEAN_2294
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:297054..299506 (+ strand)
Length: 2453
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:297054..297257 (+ strand)
Length: 204
Type: CDS
Source: GLEAN
Position: GCSC_140:297340..297640 (+ strand)
Length: 301
Type: CDS
Source: GLEAN
Position: GCSC_140:297704..298245 (+ strand)
Length: 542
Type: CDS
Source: GLEAN
Position: GCSC_140:298313..299506 (+ strand)
Length: 1194
>GLEAN_2294 class=GenePrediction position=GCSC_140:297054..299506 (+ strand)
ATGGCTACCGACGCAGCCGGCGTTGACCGCACACGCCCGCTCTATACTGTCACCAACACGGACAAGAAGCGGGTGGCATA
CTTTTACGACTCGGACATTGGCAACTATGCATACGTGACGGGCCATCCGATGAAGCCACATCGTATCCGGCTGGCGCATA
GTCTCGTTATGAACTATGGGGTCTACAAGTTCCTCGAGGTCTACGTAAGTCATTGTTCCGCAGAAGGACTCCCCCAGCCT
TTCCTTGTCCTCTTGGGCATCACGTATCGACTGACCCGTAGTTCAGCGAGCAAAACCGGCCGTTTTCATGGAGATGACAC
AATTCCACACCGACGAATACATCGACTTTCTCCAAAAGGTCACCCCGGACAACATGGACAGTTACCAGCGTGAACAGAGC
AAGTACAACGTTGGTGACGACTGCCCAGTGTTCGACGGCCTCTTTGAATTCTGCGGCATCAGTGCCGGAGGCAGCATGGA
GGGCGCCGCTCGCCTTAACCGAAACAAGTGTGACATTGCGATCAACTGGGCTGGAGGCCTGCACCACGCCAAGAAGAGCG
AAGCTAGTGGCTTCTGCTATGTGAACGGTAAGGTGGCATCGTCCGAGGTTGTGCACGCATGAAGCAATTCTAACCCAGCC
GTTCAATCAGATATCGTGCTCGCGATTATCGAGCTTCTGCGATTTAACAAGCGGGTCCTCTACATCGACATCGATGTCCA
CCACGGTGACGGCGTTGAGGAGGCATTCTATACTACGGACCGGGTCATGACGGCGTCCTTCCACAAGTACGGCGAGTACT
TCCCCGGCACGGGCGAGCTGCGAGACATTGGCATTGGCACGGGCAAGAACTACGCCGTGAACTTCCCCCTCCGCGACGGC
ATCGACGACGAGACCTATAAGACAATCTTCCGACCGGTTGTCACGGCCATCATGCAATACTTCCAGCCTGATGCAGTGGT
GCTGCAGTGCGGCGGCGACTCTCTGTCAGGTGACCGCCTTGGCTGCTTCAATCTGAGCATGCACGGTCATGCAAGCTGTG
TGGAGTTTGTTCGCAGCTTCAACTTGCCCATGCTCGTTGTTGGTGGAGGTGGCTACACGATGCGGAACGTGGCCCGGACG
TGGGCCTTTGAAACCGGAAAGCTCGTTGGTGTCGATATGGACCCAGTGCTCCCGTACAACGAGTACTACGAAGTAAGTGA
CGGCATGGGCTGGCGAAACGAGTGCGAGGGATAGTGGGGCTGACTTTTTTTCTGAACAGTATTACGGACCTGACTACGAG
CTGAACGTTCGGTCGTCTAACATGGAGAATGCTAACAGTGCCGAGTACCTCGAGAAGATCAAGATCGCGGTGATTGAGAA
TCTGAAGCGGACTGCGCCAGTTCCATCGGTGCAGATGCAGGACGTGCCTCGCCATGGGCTAGGCATGACGGACGAGGAGG
AGGCAGAGCTGGACGACCTGGACGAGGATGAGAACAAGGACACGAGGATGACGCAGCGGCAGTGGGAAAAGACCCGTGCC
AGACAGGATGAATTTGAAGAGAGCGACGACGAAGAGATGGCACAGGCGAACGGGGTGAACTACGACGGGCCGCCGAGAAG
GTCAATTCTGGACTACCGCAACCCTCATGCAGAGTACGATACGGACAGTGGAGTGGCGACGCCCGAAACAAAAAAGGAAG
GCAGCGAGATACCGGCAGTGGTAGAGGCGGCAGTCAAAGCGACGGTGGAAGTCCCAGAAACCAACGACGTGGCAATGGAG
GATGCAGAGGCGGCACCAGTAGCTGCTGAAGAGGGGGAAAAGAAAGACGAAGAGACTGCTCCTGGTTCGAATAGCGCTGT
TGCTGCTGCAAGTGCTGCTGTATCAGCAGGTGACAGCACTCCTGTCGTCGAGAAGGAAGCGAGCACAGCCGAAAAGGCAG
CAGAAGACGGCGACGTTGAGATGACAGACGCAGTAGAAGAGGCACCTGCGACGTCGGAGACTTCAGCTGTGGCCACGGAA
GTTATTGAGAAGGAGGCCGTCGTCCCCGTAGAGGCTGTCGAGGCAGGCGAGACCAGCAAGACGACTACATCTGATCTGAC
CGCCGCGCCCGAATCAGAAGCGACCAGCAAGGCCGATGCAAAGGCGGTCACGGATACTGCTACGAGCGGTGCTGCGGAGA
CCGAAATTACGCCTGTTGCCGAGACGAGCGAGACGAGCGATACGAGCGAGACGAAGGAGACGAAGGAGAAGGCGGCAGAA
GAGAAGACCACCGAGGTGACCATCCCCAAGGCTGTCGAGCAGGAGAAGACAGTCGAAGACACAACTTCCAAGAAGGAGGA
TGCCGAGAGCACGGCAGTGAAGGAAGGGGAGGCGTCAGTCGAAAAGAAGGCCGACGAGGAGAAGGCAGTGGAGGAGAAGA
GCAGCACGCCAGATGCGAGCGAGGCCAAGGTGGTCAAGAAGGAGGACGCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62