GenePrediction:GLEAN_2298 Details

Name: GLEAN_2298
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:311216..313814 (+ strand)
Length: 2599
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:311216..311507 (+ strand)
Length: 292
Type: CDS
Source: GLEAN
Position: GCSC_140:311577..311948 (+ strand)
Length: 372
Type: CDS
Source: GLEAN
Position: GCSC_140:312014..312049 (+ strand)
Length: 36
Type: CDS
Source: GLEAN
Position: GCSC_140:312900..313191 (+ strand)
Length: 292
Type: CDS
Source: GLEAN
Position: GCSC_140:313271..313814 (+ strand)
Length: 544
>GLEAN_2298 class=GenePrediction position=GCSC_140:311216..313814 (+ strand)
ATGTCTACTAACAACAGCTCCTTCCGTCTTCCCCCCAACTTCCGGCCGACTACGCTGGAGTTGTATCCTCAGCCAGCGGA
AAGCTATACTGACGCAGTGTGTGAGCATGAACGCCGCCTCATGAAGGCACCGTCGGACCAGGTCCGGAAAGAGGTAAAGG
GTATAATCAAGTACAACTCCATCCAAGAGGCTCTCGCAGCCCGTCCGCCCACGCCCTCAGGTAACTACCGGCCCATCAGC
TTCGGTCTGCCCCGACACACGCTGCCTGCTGAGACGTCTGCCGACGACGAGAGTAAGCATCTACTCCTCTGTGCTGCCTG
CCAGGCACGCGGGGCTGAAATTGAAATGACACTTCTTCCAGCTGCGCTGCAAACCCGCCGCGTCCGCTTTGTCGACCCGG
AAAACACTTGTGCCATATGTGCCAGCTTTTTGATCAGACCCTGTGGTGCAAAGGACGCGGACGAGATGACGCTCGTCGGC
AGTGACGATGACGATGATGAAGACGACGACGACGATGACGGCGAAAATCCCCACGTGGTCTACCGTGCCGTTGCAGCAGC
TTATCCGCCCGACCCGACCATGGGGAACTTCGACGAGATTTGCGACCTAACGGCCGACTTCAACGTCACTGTTGGCTCCA
TGGTTGCTCAGCAGGTCCAGGGAGATTACCTTGCTAGTATACTGAAGGCCGGGAGATCGGAGACCTTTGGGTTTACCCTT
GTCCCGGCCCGCGGTGAGTCTTGAGGCAAAATATGAATCGGGGGACTTCTTGCCCTGACCACTGACACGTTCGGAAAGCG
TTGACGCTCTACATCCGGCAGGTCTGGATTGATTGTAGAGACAGTCTTTGTGTTTATTCGTTGGGGCGCATTTCTGGTTT
ACTTGTTGTTTTCATGCTTTCTTCCCCTGTTCCTTGCTAATCGCCGTGATACTTTGCAAGTCATTGTACTTAGTCCCGTA
ATAGTATCTTACATTGTCTCTACATTATTACAGCGTTAAACTTAATAATTACGCTCCATTGATGAGACGCGCAAACTTTG
ATGAACAAGCTGGAAATGGCTATCCTCAAAGCTATGCATCGATGCCACCCAGTGACCATTTTGTAACAGTGGGCCTCCCT
TTTCCAGAGGCCATTGTCGCCTGAGAAATCTTGACACAAAGGCAATCGATATCTCTCCTTTGGAGTGACTTGGGATGCTG
GCCGTGAGCCAGCATACTGTAAAGTAGGAAATGAAGAAAATTGTCGTTACGGTCTCTCCTGTTTGATCTTGTCTACCTGT
CGTCTTTCCAATCCTGTGAGCAACTTTGGTGTAGCGGTAACATCTACGCTTCCCATGCGTAGGCTCCGGGTTCGACTCCC
GGAAGTTGCAAGTTGCAATCTCCAAGGATATTTTTTGCACCCCATCTACTCATGCAGCCGCTTTTTTGGCCTTTCTAGCA
CGACAATTCGGACCAGAGGACTTTCATTGGATTGAAGGCCAAGCTGTGAAAATAAGGACGGTTTGCTTTGCCAGCTAACG
CAAGTGGAGCGGACCCACTAAAAATTTCAGGTCTTTCTTCAAAAAAATTGAGAGACGAAAATAGCTTCGACTGTAGAAGC
ACAGCAAAGACAGAAGCCAGCCATCCATTCTTCCGTGCACCCATCCTGGAACCATGCCTCTCGACACGTCGACATACTCA
CTAGCGCTCCTGCGCGTGGATGGGCGCCGCTGGAACGAGCTGCGGCGCTGCCACGCCGAGGTGCGCACGCAAGCCGCCGC
CGACGGTTCCAGCTACCTCGAGATGGGCAACACCAAGGTCATGTGCGTGCTGACGGGACCGAGCGAGGTGGGCCAGAGCC
GCGCACGAATGGCGGGCGGTGGCGGCGGTGGTGGAGGTGGCGGTGGTGGTGATGCCAAGGACGCCGAGGTGATTGTGAAC
ATTGTGGTGGCCGGGTTCAGCTCGGTGAACCGGCAGCGGCGAAGCCGGCAAGACAAGTAAGTGATGACGGTGGAGGGCGG
GTGACTACAGGTGACGATGGGTGATGGCGGGTGCCAGAAATGCTGACACGGGTAGACGGACCCAGGAGATGGCGGCGACG
ATCTCGCGGACGCTGGCGGCTGTTCTGCACACGCACCTGTATCCGCGCAGTACCATCACGATCAGCCTGCACGTCCTCAG
CCAGGACGGCTCGCTGCTGGCGGCGCTGATCAACGCGGCCACGCTGGCGGCCGTCGACGCCGGCATCCCCATGGCCGACT
ACGTCGTGGCCTGCTCGGCCGGCAGCTCGTCCAGCTACGCGGCTGCCGACGACGCGGCTGATCCGCTGCTCGACCTCAAT
CTGCAGGAGGAGCAGGAGCTGCCCGGCCTGACCGTTGCTACCCTCGGCGCCTCCGACCGTGTTGCCGCCCTCGTGTGCGA
GAGCCGCGTCCAGGCCGGCCGCCTCGAGGGCATGCTCGCCGTCGCCGTCGATGGCTGTAAGCAGGTTCGTGCCATCCTCG
ACAAAGTCGTTCGTGAAGCCGGCGCTCGCTTCGTCCTGCAGGATGACGCGACTGCCGGTGGTGGCGGCAGCGGGGACGAC
GAAGACGAGGAGGCCTCCGCCATGGAGATCGACAACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62