GenePrediction:GLEAN_2299 Details

Name: GLEAN_2299
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:316118..317340 (+ strand)
Length: 1223
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:316118..316226 (+ strand)
Length: 109
Type: CDS
Source: GLEAN
Position: GCSC_140:316290..316572 (+ strand)
Length: 283
Type: CDS
Source: GLEAN
Position: GCSC_140:316644..317340 (+ strand)
Length: 697
>GLEAN_2299 class=GenePrediction position=GCSC_140:316118..317340 (+ strand)
ATGGCTGACGAACCCCCCGCTGTCCTGCGGCAGGCCGACCCGAACATCTACAAGACGGCCACCCGCGCGGCGCAGCTGCA
GTCCGTGAAGCCGATTGTGTCCTACTGGTGTACGCATGCTACATCCCCATTTTATTCCGGAATAGGATTCTTTTCCTAAC
GATCGAAAACAGGCGATTACTGGGTGCTGAAGCAGATTCTCGCAAAGGGCCTGCACAACAGCAGTCCCGACATACTTGAG
TACAGCTCGCATCTGATGGACAAAATGGAACAGGCAAGTCTGGGAGAAGATCGTCATAGAGATTCTCGGGATACTGACTC
CAGACAGATCAAAGCAGAACATGCTACCGAAGATGCGATCCTCGATGACACGGCTGGCCAGGCCTACGTGGAGCAGTTTG
CGCAGGAGACGCTGGACCGGGCGCAACGTGTCGTCCGGGCCAACAAGGTGACAGCGTGAGTGCTGAATGGAGAGGACAGA
AGGACAGTAGGCCGGAAGGGTGCACTGCTGATGAACAACCATATAGAATGACGGCAAACACATTTGATGCCGCCGCTTCG
TTCTTCGGCCTGGTCAACATCTGGGGGTCACCGGAGCAGGAGAACCTGCAGAAAATCAAGTACGCCAAGTGGAACGCGGC
ACGAATTCTGAAGGCCCTCAAGGAAGGCAAAGATCCAAACGAGTCGAATCCGCATCTGGACGAGGAGGAGCCCGGACAGG
AGCTGGAGCCGCAAGAGAGCTTGTCGCCTGGCCCCGCAGCGCCAGCAGTCATGACACCACGACCCGTGACGATCGAGGAC
GAGGAAGAAAACGACGGCGATCTGCAGCTACCCGACGCCCCTTCTGCTGCTGCTCATATCGATGACACGAATCCGTTACG
TCCGTCAGCACCACCGGCGATACCATCGGTGCCGTCTTTTGACCCGGCTGACCAGGTCGACGCGCATGAATGGGCGGCTC
CCACGCCATCTCCCCCGGCTGTCCAGCCGGAGCCGTACTACCAGCAGCAGCCTCAGGGTTTCTCGTCCGCGCCCTCGGCA
GTCACAGGCTTCCCACCGCTATCACAGCCACGGGCGCCGGCAGCAGCAGCAGCAGTCGATGAAGCAGCAATGGCGATGGC
GCAGAAACACGCAAAGTGGGCCATCTCGGCATTGAACTTTGAGGACGTCACGACAGCAGTCCGCGAGTTGCACAGAGCGC
TGGAATTTCTGGGTGCTTCCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62