GenePrediction:GLEAN_22 Details

Name: GLEAN_22
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:163954..168090 (+ strand)
Length: 4137
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:163954..164026 (+ strand)
Length: 73
Type: CDS
Source: GLEAN
Position: GCSC_179:164153..164226 (+ strand)
Length: 74
Type: CDS
Source: GLEAN
Position: GCSC_179:164275..164559 (+ strand)
Length: 285
Type: CDS
Source: GLEAN
Position: GCSC_179:164616..164946 (+ strand)
Length: 331
Type: CDS
Source: GLEAN
Position: GCSC_179:164990..165245 (+ strand)
Length: 256
Type: CDS
Source: GLEAN
Position: GCSC_179:165462..166915 (+ strand)
Length: 1454
Type: CDS
Source: GLEAN
Position: GCSC_179:166974..166984 (+ strand)
Length: 11
Type: CDS
Source: GLEAN
Position: GCSC_179:167054..167271 (+ strand)
Length: 218
Type: CDS
Source: GLEAN
Position: GCSC_179:167337..168090 (+ strand)
Length: 754
>GLEAN_22 class=GenePrediction position=GCSC_179:163954..168090 (+ strand)
ATGCAGACAGCAAGCATCAAGGCATACTCATCCAGTCACTGGACGACGGATGACCCCACATTATGCCAAGCTTGTAAGCT
TACCAATCCCTCAATCCTTCATCTGGAGGCAGATATCTATTTATCAGCCGACAGCCACGCAGAAACGCTTCCAGACATAA
TACCTTGCAGCGGACATATGGCACCCACGATGAAAGTAGCAATTGTCGGCGCAGCCGGAGAGACGGGCACCTCCATTATC
CACGGCCTTCTCGAGTCGTCCACCACGCAATTTGTACGTCCGGTCTGGATTCCTGCATGGACTGAAGCTGACCTTGAACA
GGAAATCACGGCTCTCACGCGGCCATCCTCGCTCACCAAGACAAAGAATGTCGAGCTCGAGAGACGGGGTGTGAAGCTGG
TCGCGGCCGACTTTGCCGGCCCGGAAGCTGAGCTGGTCAGGCTGCTGGACGGCATCGAGGCCGTCGTTGTGGCGGTCGAC
CCGCACAACTTTGGCCTCCAGATCCCGCTGGCTAACGCGGCCAAGGCGGCCGGCGTGCAGCGCTTCGTTCCCTGCACGTT
TGCCACCGTGGCGCCGCCAAAGGGAGTGATGCAGCTGCGGGAGATGGTAAGCTGGAGGATGTCTTGCTTAGTGGCCGCTC
GTCGTTGCTGAGACCCGGACAGAAAGAAGACGTGATCAACCACATGAAGAAAATCTATCTGCCCTACACCGTCATCGACG
TCGGCTGGTGGTTCCAACTTTCGATCCCATCGCTGCCGTCCGGCCGCACGCAGTATGCCATCTCGATGTCGGGCGATGTC
ATTGCCGGCGACGGCACCGTTCGGTCTGCCCTGACAGACATGCGCGACGTTGGGCGGTATGCTGCCCGCATCATCGCGGA
CGCGCGGACGCTGAACCGGATGGTGTTTGCGTACGGCGAGGTCCGGTCACAGAACGACGTCTTTGGCCTGCTGGAGAAGA
TCAGCGGCGAGACCATTGAGCGCACCCATGCAAGTGCTCGCCTCTGTCGTTCCGTCTTGTCCTTTGCTAATGGCAGACGT
CTGGCAGATTTCGGAAGCTGCCATCCTGGCCAACATCGAGAAGGCCCAAGCCTCGAGCGACCCCAAGTCGGCCCAGACGC
TGTGGCTCGCGCAGTACATGCATTCATGGGGCATCCGTGGTGACAACACGCCAGAACATGCCCGCTATCTGGGCTATCTG
GACGGTAAGGAGCTGTATCCGGACTTCCAGGCAGGCACCCTGGAGGCTTTTCTCACCGAAATCCTCGATGGCCGGGCGAG
AGCTGTGTACAAGTAGAGACAAAGGACCTCTTACGGGACCAAAGCAGTCTCGGGCAATTTCCATCTCACCTTTGGCTCAG
ATGGCCGTAACTGCAAATTCTATGCCAAGCTCAGATATGTGTCGACGAACAGACGAACCGGACAATGCTGAAAGATTGGA
AGAGCAAAGCTTCCCCTTTCAAAACATAATTTTGTCAATGTCCACCTCCAACACACAATGCCTTCCAGCATGGAGGCCAA
CGGCAACGACAGCTCGCCTCTTCCTGTGCCGTACTCGGTCTTCTCTCGACGAACGCGCACATTCCTTACCTACCTCCTCG
GCGTCATCACTGTCTTGTCCACGCTCACGTCCACGATCTACTTCCCGCTGCTGCCTTTGCTGAGCCGCCAGCTGAAGGTC
TCGGCCCAGGCCATCAACTTGACTGTCACGGCCTATTCCGTGGCCCAGGCCGTCTCACCCGCCTTTTTTGCCTCGCTGGC
CGACGCTCGTGGCCGTCGTCCGATTCTTCTCATGCTCGTCGGCCTCTATGCAGCCGCCAGTCTCGGTCTCGTGTTCGCTC
AGCGACAGCGCAGCTATGCCGCCCTGCTGGTCCTACGTGTCGTCCAAAGTCTCGGCGGCTCGCCGCTGCCAGCCTTGGCC
TACGGCATCGTGGCCGACGTCGCCCTGCCGGCCGAGCGCGGCCGCTTGTTAGGTCCGCTGCAGTCGACGTGCAATGCCAT
CTCAGCCGTTGGGCCGGTTGTCGGCGGTGCCGTTGCCCGCGTCACAGCTGGCGCCCTCTGGGTCTTTGTCTTGCTGGCTG
TCCTGGCTGCCGCGCTGCTGCTGCTGGCCGGCCTCAGCTTGCCGGAGACAGCCCGCAGCATTGTCGGCAACGGGAGCGAA
CAGCCGGTCAGCGTGTGGTGGCGGACACCGTGGCGTCCAGCCAACGCGATCACATCGTTTCGCATCTTGTTTTACCCTGA
TGCTGCGGCTGTGCTCTGGACCGTGGCCGCTCCATATGCGGTCTACTACACGATGCAGGTGGCCATTCCGACCATCTTTG
CCGACATCTATGGCTACGATGAGCTCCAGATCGGCCTCGTCTTTTTGCCTGGTCTCGCTGGCATGACCATAGGCGGACTT
GTCGCCGGCAGACTGGTCGACCGCAACTACGCCAAGATGGCCAGCGAGCATGGCATCGAGATCGAGATGACAATCGACCG
CAGCCAAGCGCAGGCCGAGCTCATGCACTTTCCTATTGAGGCCGCTCGCTACCGCCATGCTCTCGTCTTCGTCGTCGTCA
TGGCTGTCCTCGTTTGCGGCTATGGCTGGGCCGTCCAGGTCCGGGTCCATCCGGCCGTGCTGCTGGTGCTCCAGGCACTG
ATCTGTGCCAGCTCGATGCTGCTCGGCCACACGGCCAGCACCCTGCTCGTCGACATCTTCCCCGGCGAGGCCAGCTCGGC
CTACGCCGCGGGCCAGATCGTGCGCTGTGGTCTCGGCGCCGCCTCGGCCGCCGTGCTGCAGCCGCTCGTCCAGGCTATGG
GCTACGGATGGTACTTTGTCAGCTTGGCCGCCGTCGTCGGCCTGGCCGCGGCGCTGTCGGTCGTCGTCAGTCGGTGGAAA
GGAATGGCGTGGCGGCAGAGACGCGGTGGAAATGGTGGACGAGATGAGCGAGAGGACGGTTTGCCGTCGGAGGAAGTGAA
AGGTTAGGCTGTCTGAGATGTTGTAAGAAACTGCTTGTAATGTCATGAGCTTTCTGTCAGTATGCATTTCAGTGAGTGTC
TGCCTCGGATTCGCGTAGCTTACTAATCACCGTAAACGACAGCGGACTTAACGCTGTCAGCGACAAACGCCGGAAACGGC
AACATCCCGCCGTCAGTCCCTCGACCACTCTCGACCACCCGACAAGACCAAGGACGGAATGGAAGCCCACGCACCCAACA
CAGCCCAGCACCTGGTCGACACGGCGCGGGGGCAGTATCTGGTTCAGGTGTCGTGGCCGCTGGACTGGACGGCGGACGGA
AATCCGAATGGGACGAGCATCGACAACGTCCCCGTCATGTGAGAGCGAACTGTACTCTGTACGATACAGACTCCCAACCA
GACGACTGGCTGACGGCGGGCAGCTACTGTGTCGATGGCAACGTCTTCTTCTTCACGGCGACTGACATTGTGCGCCGGCT
GCAGTACTTTGCCGACAAGCGGGCCATTGTCGTGGGCATCGGCTATCCCCTCCGCCATGCCGTCTATGCAGACCGGCGGA
AGGCGGACCTGACGCCGCCGAGCCTGGTGCGGCAGCCGGAGGACGTGCTCGGACGTGACGGTCGGCCGCTGCCGGATGTG
CACCACGGCGAGGCCGAAGCCTTTCTCGACGTCCTCGTGGAGGTGATCGTGCCGTTTGTCGCCGTGCATGTCCTGCCGGC
CGTGCCGCTGTGCCGCCTGCGCCAGGTGCTCTTTGGCCACTCGTTTGGCGGCCTGTTTGCGCTCTACGCCCTCTTCACGC
GGCCGCACCGCTTCGACACCGTCGTGGCCGCCAGCCCGTCCATCTGGTGGAACGGCGCCAGCATCGTGCACGAACAGGAG
CGCGCCTTTCGCGACGGTCCTGCGCCGGCCCGGAAACCACACCTCTACCTCACCTACGGCACCTACGAGCAGCACCCGCC
CCGACGGCCGGCCGACTCGGACGAGCAGTACGAGCAGCGCAAACAGCTGGCCGCCGGCTATCGCATGGTCGACAACACCG
TCGAGATGAAGAACCGACTGCAGACCAGCAACCGGCTCGAGACCGTCTGGATGCAGGAGTTTACCACCGAGGACCACGGC
GGCGCCTCCGTGACCGGCCTGCAGCGTGGCATCATGAGACTTCTCGGCGAGTTCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62