GenePrediction:GLEAN_2300 Details

Name: GLEAN_2300
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:320148..322730 (+ strand)
Length: 2583
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:320148..320551 (+ strand)
Length: 404
Type: CDS
Source: GLEAN
Position: GCSC_140:321092..322730 (+ strand)
Length: 1639
>GLEAN_2300 class=GenePrediction position=GCSC_140:320148..322730 (+ strand)
ATGCCGTCTCTAAAGGCCTTGGCCATTCAGGCAGAGTCCATTCATGCTGAAATCCAAGAAGCCACTACGGATTTCGTCGC
GGAGAGGAGTGCCAGTCCAGAGCTGGCACAGCTGGAGCATGTCGACTCCTGGCCATCGGAGGTTCAGGGGCACCGGTCTG
ACACGCCCACGACAGAGCCCGACGCGGGATTTGCGAGCGCGCAGTCCACCGTGGGTCTCACCAAGATGGCCCTGTTCCAG
CCCCAGTCGACAGCTACACGCGAAGCGGCCGCACTATGGTGGGCATGGAAGCATTTGCATGCCCAGAACAAGCACTTCCA
TACCCACACCATCCTTGGGCGGTGCAGGCTCCTGATCGATAAGACGATTTGCAAGACCCATGGTGATACTCTAGTTTTAC
AGAGGTAAGCGGTAGAGGTAGCAATGCTGGCTACTCGACGAAGACGCTAGGCTTCCGTGTTCCTTCATATAAGCTACTGC
TATATCCAGGGCATACCTAGCCATACTAGCAGATAGTGTAGTTATTATCAAAACAGCACGCAGCTTTTACTCTACCACAG
CAACAGCTTACATACACCGTCAGCACTAAAACCTTACTAACGGTGGGTCCTTTTCAACACGGAGAGTGATTGATTAATAA
GAAATAACTGTTGGAACTGTTGGAAGTTTGATGGGCTTAGGCCACCGCTACTAAATATTAGCAATACGGAAGGTTTGTTT
ACCTCTTATTTGCCCCAATAAGGAGCAAGTCGAACCAAGGGAAAAACAAGCTTCTTCGTCGTCTAGCACAGTCGTCAAGT
TCGTCACCTCTTCTAGTGCCTCGCCATTTTTTTTTCTGTCGATAAACAGTCCGTTACCTATAGGCAGACGGCATAACGGT
GCAGAGAGCGCACGACAAGATGGATAAGGTGGATGGTAGAAGCGCAGGGCACCTGCGCTAACAGCACTCCAGAAGCTAAG
GAGGTGGAGATCAATGAGATCAACGAGATCGCCAAGACTACCGAGACTAACAAGACCGCAAAGGCCACCGAAGCTGCGGA
GACTATGGGGGCAGCTGCAGAAGAAAACCGATTAGCAGACAGCAATGGGAATGTTATGCCATGGTCGGTGTGGTCTTCGA
GGCAACGGAAGCTGATTGTCCTGACAGCCTCATTTGCATCACTGCTATCGCCACTGTCGAGTCAGATCTACTTTCCAGCT
CTAGGAGCGATTGCCCGGGACCTACAAGTGAGCGACAGCCTTGTCAACCTCTCGATCACGACGTACGTGATTCTACAAGC
CATAGCGCCGACATTTACGGCACAGCTGTCGGACGAGGTGGGCCGGCGACCGCTCTACATGACGTGCTTTGTGCTATACA
CAGGGGCCAACATCGGGCTGGGGGTGCAGCACAGCTACACGGCGCTGCTCGTGCTAAGGTGTGTGCAGAGCGCAGGAAGC
AGCGGCATGGCGACCCTGGCGAGTGCCGTGGCCACGGACCTGACAACGCCAGCCGAACGCGGCCGCTACATTGCCTACGC
GGCTGCCGTGCCTATGCTGGGGTCGACACTGGGGCCTATCATCGGTGGCCTTCTGGCCCAGTTTGCCGGCTGGCACTCCG
TTTTCTGGTTTCTGGTGGCGTTGACTGGCGTCGTCGTCCTCGTGATGGTCCCTCTCTTCCCCGAGACCTGCCGCAAGATC
GTCGACGACGGATCCATCCCACCGCAGCGGTGGAATCGCTGCTACGCCAACGTGCTACTCGAGAATCGTCTCACGGCCAC
GTCTCAAGAAGGCTTGTCACAGCTGCTCGCAGCCCGCACCGAGCGCGACGCGCGCGCGAGGGCGCGTCCCCGCGTGCGAC
TGCCGAACCCCTTGGCCACGCTGCGGCTGCTGTTGCAGCGCGAGTGTGGCGTGGCTCTGCTCTATAGCGCGCTGCTGTGC
TGCTCATTCTACGCGACGCTGTCCCTGATCCCGTCGCAGTTTGGTGCCGTCTACCACTTCAACGAGCTGCAGATTGCGCT
TTGCTACATCCCCTTTGGCCTCGGCAGCCTTGTCGCCGCCTTTCACCGCGGACGCATGCTCGACGCCAATCTGCAGCGCC
ATGCCCGCCGCCTCGGCATCGTCTTGGAGAAGAACCGCAACACCGATCTGGCCGACTTTCCCATTGAACGCGCCCGCCTA
GAGGTCGCCCTGCCTACTATCGTCCTTGGCAGCGCCAGCATGGTTGGCTTCGGTTGGATGCTGCACGCCCAAGTCAGTTT
GGCCGGGCCGCTCATCTTTCTGTTTGTCATGGCCTTTTGCATATCGTCCTCGCTCAACTGCGTCGTCTGCCTCATGCTCG
ACGTCTACCCCAGACAGGCAGGCGCCGTCACGGCCGCCAACAACCTTGTCCGCTGCCTCTTCGGCGCTGCCGCCACCGCC
GTTGTCGTACCTATGATCAACGGCATCGGTGTGGGCTGGGCCATTACTATCTTTGCCGTCATTAACATCATCGCACTACC
GCTGCTGTGGTATGTTATGAAAAGGGGACCGGTCTGGCGTGCCGCGACGCGGCAAAAGAATCTGGATAAAAAGGCAGCCC
AGGGAGTTCCTCAGGCAGTCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62