GenePrediction:GLEAN_2301 Details

Name: GLEAN_2301
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:325863..327589 (+ strand)
Length: 1727
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:325863..325865 (+ strand)
Length: 3
Type: CDS
Source: GLEAN
Position: GCSC_140:325925..326050 (+ strand)
Length: 126
Type: CDS
Source: GLEAN
Position: GCSC_140:326106..326169 (+ strand)
Length: 64
Type: CDS
Source: GLEAN
Position: GCSC_140:326220..327135 (+ strand)
Length: 916
Type: CDS
Source: GLEAN
Position: GCSC_140:327202..327589 (+ strand)
Length: 388
>GLEAN_2301 class=GenePrediction position=GCSC_140:325863..327589 (+ strand)
ATGGTGAGATATGCGCGCCGATTGGGCCCGCATACATCTGAAGTCTGACTTGTACTAAACAGGCCATGAATGTGGGCGAG
AGTCCGTTTGATACGACTGTCGATGAGCTTGTCGCCAAGGCAATGTCAGAACTGCATGTTCCAGGACTTGCGCTAGCTGT
TTTCGACAGAGATAAGATATGGTCAAAGGTATTTATATCGTACGTCTTGCCAAATTATGCTTACTGATCTGCTTCCGTGT
CAGGGTTATGGTGTCACGAATGTCGATTCCGGAAGCCGGGTGACTCCAGACACCATGTTTTCGGTAGGTACAGTGCGCTA
TTTGCATTCTGTTGTAACCTTTCTAACCCAACATCAGGAAGCACCACGAAAACGTTCACGGCTGCAGCTGCATCCTTGCT
TGTGGATGACAACGAGGAGCACTCGGATGTTACCTGGGAAACACCGATGAGTAAGCTTATCCCGGACGACTTTGTTCTCC
AGGATGCGTATGCCACTGCACATGTAACACTAGAGGATTGTCTTTGCCATCGAACGGGACTGGCCACACACCGGGCCGAC
CTTGGGGGACACTCAGTCAAGGAGAACGTACGAAACCTGAGGCATCTTGAGCTGACGAAAGAACTCCGCACAAAGTGGCA
GTACTCAAACCACATGTACTGGGCCGTGTCGCACGCGATCGAGGAGAAGTCCGGACAGGACCTCGGTACTTTTATGTCAA
ACAGGCTTTGGAGGCCTCTGGGGATGGATGCCACCTTTCTCAGCATTGCAGATGCTCTGGATTATGAGAAGGCTCATCCG
GAGACGAAGCTAGCTGCACCGCACAAGTGGCACGAAGAGTCCAAGTCCTTCAAGGTAATGCCATTTTGGGACGATGTTGG
CATCAGTGGTGCGGGTGGCATGGTCTCGAGCGTGTCGGACTGTGCCAAATGGATCCGCGCCTTCATCGACAAGGCCGCCC
CCATTTCTCCAGATGGCTACAGCGCCCTGACAAGTGCTCATATGATCCAGAAGGCTAGTCATTCTCGCTTTACAGGACCG
GTCTGCTACGGTCTCGGCTGGTTCATGTCCGTGTACCACGGAGAGAGGGTTTTATGGCACCCGGGCGGACTGGTTGGGTC
AGTTTCCAGCTTTATTTACCTGCCTGAGCGTAAATGGGGCATCGTGGGCATGTGCAATGTCACAAGTGAGCAGGCTATCG
AGGCACCGATGTGGCATCTGATTGACGAGCTGTTGTCTGTACCACGGGAGAAAAGAACCGACGTTGTTGCTAAGTATGTT
GAAATGGGTTTGCCTATTTCTAATATCTAGACACTAGAGCTAACATGTTCTCTTTACAGGGCGGTTGCAGAACTGCAGGA
CATGAAGGCCTTTTCCAAAGGGGCTAAAGGTATAATGTTTCCTGGTCGGCCAGAGACACCTAAGCCATCTTCAGCTCCTA
TTTCAACCTACTGCGCAACCTACTCTCATCCCTCTTACGGATCTATCATTGTAGACAACACCGAGGACAAGGCGGTGTTA
AAAGGAGCCTTTCCTGGGAGGCTTCCTCTTGACCCATTGTTTCTCGAGCATATTGACGGCGATAATTTCCTGCTGAAAGC
AGATATCATTGAGTTGATACCGGTACGAGCGAAGGCTAAACTCGAGATTGATGAGACCGGCGTGCCCGACAAGTTAGGCG
TGGAATTCGGGGACAGCATTACAACATGGTTTTGTCGAATGAAATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62