GenePrediction:GLEAN_2302 Details

Name: GLEAN_2302
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:328347..329464 (+ strand)
Length: 1118
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:328347..328398 (+ strand)
Length: 52
Type: CDS
Source: GLEAN
Position: GCSC_140:328465..329014 (+ strand)
Length: 550
Type: CDS
Source: GLEAN
Position: GCSC_140:329083..329464 (+ strand)
Length: 382
>GLEAN_2302 class=GenePrediction position=GCSC_140:328347..329464 (+ strand)
ATGGTTCGGATAATTGGAAAAGAAGTTGGACCCATTGGCGTTGGCCTTATGAGTGAGTAGCAATCATCTCCTCCTTTCTT
CCTCGTTATCAATTCCCTAACTCTATGCTTCTGACCAGGCCTGACGCGTCCTGGCAGCGGTGTAAATGACGAGCAGGCTT
TTGCTGTTCTGCGCCGCGCCATCGAGCTTGAAGCGTTCTTCTGGAACGGAGGCGAGTTCTACGGGCCCGAGAATGCTAAC
AGCCTCGTGCTGCTAGAAAAATACTTTGCCAAGTATCCCGAGGATGCCGACAAGGTGGTACTGAGCATTAAGGGTGGCTC
GGACAAGCCGAACACGTTCCACTTTGATAGCTCGCCGGCCAACGTGCGGCGCTCAGTCAACGACTGCGTGGAACAACTTA
AGGGTCGCAAGACGATTGATCTTTTTGAGTTGGCCCGCCATGACGGCGTGACGCCATGGGAGACCTCAGTCAAGTCGCTG
CTGGAACTTAAGAAGGAGGGCAAGCTCGGTCATCTCTCCCTGTCTGAGGTGCGCGCCGAGTCGATTCATCGGGTGGCCAA
GGTGGCCAAGATCGAAGCCGTCGAGATCGAGCTCAGCATTGTTTCGCCTGAAGTCCTCACAAACGGTGTGACTGCAGCCT
GCTCACAATATGACATACCGGTTATTGCGTGCGTGCTGCCGCCCAGCCACCTCGTCTCACATTTGTCCGCCTGCCTTCGC
TGACTCTGCTCTACAGCTACTCTCCCATCGGCCACGGACTCCTTACCGGACATATCAAGTCACAGGATGACCTGAACTGG
GTGGCCAAGATGTTGCCGCGATTCTCGCAGGAGAACCTGCCAGCCAACCTGAAGTTAGTGGAGCAGATCGAAAAGATTGC
TGCCGACAAGGGCTGCACGACCGGCCAGCTTGCCATCAACTGGGTCCGCTGTCTGTCTAGACGGCCTGGCATGCCGACCA
TTGTCCCGCTTCCTGGCACTACCACGATCGAGCGGCTGGAAGAAAATCTTACGCTTGTCGACTTCTCGGACGAGGAGATG
GACACCATCGACGACATAATCAGCAATTTTGAAGTCAAGGGCGACCGGTACCCTTCTCACCTTCCGACTGAAACGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62