GenePrediction:GLEAN_2304 Details

Name: GLEAN_2304
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:333244..335002 (+ strand)
Length: 1759
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:333244..333385 (+ strand)
Length: 142
Type: CDS
Source: GLEAN
Position: GCSC_140:333455..333627 (+ strand)
Length: 173
Type: CDS
Source: GLEAN
Position: GCSC_140:333695..333947 (+ strand)
Length: 253
Type: CDS
Source: GLEAN
Position: GCSC_140:334014..335002 (+ strand)
Length: 989
>GLEAN_2304 class=GenePrediction position=GCSC_140:333244..335002 (+ strand)
ATGGAATTTCTCTCATCGGAAAAGAAACACAGCTTCAACCGACCTCTCGTGGGAGCCACTGTTCTGGTAGTTGTCTTGGT
GTGGTTTTTGGTGATCCATTTCACTTCTCCCCTGAGAACGTTTCCTGGACCATTCTGGGCGAGTAAGCCATGACACAATA
CGATACGTCGGCGGGATGTGCAAGATAAAAACTTCTAACCCGTGTTTTCAGGGTGGACAAATATTTGGAGACTGTATCAA
GTTTCGACTGATAAGTACCAGTGGACCATCAAGAGGCTCCATGAGAAATATGGCCCAGTGGTCCGTATCGGCCCAAATCT
ACTAGATCTAGACTATCCAGAGTTGATCCAGACTTTGTATAGCACCGATGGCAAGTGGAACAAGGTTGGTCAAACAGACA
TGTTCTTGTAGATTCCTTCGCATATGCCGTATCAGACGCTAAGTGACAAAGACCGAGTTTTATCAAAGCCTCAGCGTTGT
TGTCGATGGAAAAATAACCCACGACGTGTTCAGTACGTCGAATCAAGCCGAACATGCCCGCATGAAGCGGCCGATCGTTA
AGTACTACTCGATGAGCAGCGTTCTCAAACTAGAAACGCGTGCCAACGACGTTCTTAGCGACCTATGCAGACATCTAGAG
CATCGCTTCATGGACGGGGAAAACGAGGGCAAAGATTGCAACTTCGGAGAATGGATTGCTTTTTGTAGGCTACCACTATC
GAATGCTGTTTTCTGAAGGGCCATGAATTGCTGACATCGCATACCGGCAGACACCTGGGACTTCATCAGCGCTGCGACCC
TTAGCACCCGATTTGGTTTCATGGAAAAGGCCGATGACGTGGATGACACTATCCGAATTTCCGACAAAGGAATACATTAT
TTTGCCATGGTCGGCCAGATGCCCTTTTTGGATTTCCTCCTAGCCAAGAACCCGATAAAGCGGATCGGTCCACCAAATCT
GCAGAATGCCAATCGCATCGCTCTCGAGCATATGTTTGGGCGATTCAAAGAGGATCTCGACAGTAAAGAAGTCGAGACGC
GTGATTTTCTGGACCACTTCATTGAGGCGAAGAAGATGGCTCCTGACTCAGTGGACGAGAACCTCATTATGTGCTCCCTT
TTGGTGAACTTGATCGCTGGGGCTGACACGACCGCAACCACTCTTCGTGCCATATTCCATTTCTTGATGACAAATCCCCA
CACTTTGAAAAAGCTCGAGCAAGAGGTCCTCGCTGCCAACTTCGAGCCCGAAGGCGTGGTACCATACAGCTCAGCTCGTG
CGCTGCCCTATCTCGATGCTGTCATTCGCGAGTCCATGCGGATGCACCCAGCCGTGTGTATGCCTCTGGAGCGCTATGTG
CCCGACTCTGGACTCACACTACCCGACGGCAGCTTTGTGCCTTCTGGCACGGCTGTTGGCATCAACCCGTACATTGTGGG
CAGGAACGAAGGCGTATGGGGTCCAGACGCCAACGAATTCCTCCCTGAGCGCTGGCTGAAGAATGACGGTGAAGACAATG
ACACTTACAAACGACGTTTGCGCCAGATGAATGCTGCCGACCTCGCCTTTGGCGGGGGTTCCCGGATCTGCCTCGGTCGC
AACGTGGCCTTGTTGGAAATTTACAAAGTTGTCGCCACGCTGGTGTTGCGCTACAAGATCCTGCCGTCCAAGGTACCCAA
AGAGTTTGTAATCTTCTCCTCCTGGTTTTCTCGCCAGTTGGGGTTGGTCTGCAGACTCGAAAAACGCCAGGTGACGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62