GenePrediction:GLEAN_2306 Details

Name: GLEAN_2306
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:340238..344171 (+ strand)
Length: 3934
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:340238..340520 (+ strand)
Length: 283
Type: CDS
Source: GLEAN
Position: GCSC_140:340675..341057 (+ strand)
Length: 383
Type: CDS
Source: GLEAN
Position: GCSC_140:341120..341453 (+ strand)
Length: 334
Type: CDS
Source: GLEAN
Position: GCSC_140:342118..342403 (+ strand)
Length: 286
Type: CDS
Source: GLEAN
Position: GCSC_140:342455..342693 (+ strand)
Length: 239
Type: CDS
Source: GLEAN
Position: GCSC_140:342753..342865 (+ strand)
Length: 113
Type: CDS
Source: GLEAN
Position: GCSC_140:343068..343087 (+ strand)
Length: 20
Type: CDS
Source: GLEAN
Position: GCSC_140:343709..343992 (+ strand)
Length: 284
Type: CDS
Source: GLEAN
Position: GCSC_140:344059..344171 (+ strand)
Length: 113
>GLEAN_2306 class=GenePrediction position=GCSC_140:340238..344171 (+ strand)
ATGTCGGCAAATCTGTATCGCACGAAACGGCCAGAGCAATACTACCATATTCACGGCTCCTTGGAAGCATCAACAACACT
GCGAATGATAGGACTAGAGCCTTTCCGCCCGGATCTCACGGAGCACAAAGATATCGTCGATACAATTGAGTCCCATGTTG
AGAAGTACACGATCGAAGAGCTGGAAGAACTCAATGCCAAGCATACGCAAGCTGGCGTGCCGGCATTCAAGCATGAAGAG
TTTTTACTCACTCCCCATGTACGGCCAAACCTCCTGCATATGAGTGTGTCATAGTCCTTCTTATCATTTGTTGACAAATC
GAAAGGGAAAACTGAATTCTACTCAACCGCCATGGAAAGTCGAAAATCTAGAGACTGAAACTGCCCCATATTCTCTGCCT
CGTTCAACGACTAACAGACCACTTTCGGGAATCAAAGTTCTCGAGCTCTGTCGAATTGTTGCCGGGCCGACGATGGGCCG
CATCCTGGCCGAGTATGGGGCTGATGTATTGAAGATCACAAGCCCCAATCTCAGCGATGTCCCGTTTTTCCAAGTGGATG
GAAACATGGGGAAGCATGCCGCTAATATCGACCTAAAAACGGTCGAGGGAAAGCGGCTATTTGAGGAACTGGTCCAAGAT
GTGGACGTCGTCCTCGATGGTTACAGACCTGGAGCCCTCAGCCGACTAGGATATGGAACACAGTTCATGACCGAACTTGC
AAAGAAGAGAGGACACGGGGTCGTTTACGTCAATGAAAACTGCTTCGGCTATGAAGGCGAATGGGCCTCCCGACCAGGAT
GGCAGCAGATTGCAGACTGCGTGAGTTTCCGGTTCTTGTTGCTGCCTATAACATGTAAAGGCTAGCTGACGTGACTCTAC
AGGTTACGGGACTGGCGTGGGAGCAAGGAAAGTTTATGGGCATTGATGAGCCTATCGTGCCTCCGTTTCCCATATCAGAC
TATGGAACGGGGTGCATTGGCGCCATCGCGGCTCTGACAGGACTCTACAACCGTGCTACCATTGGCGGGTCGTGGCACGG
AATGGCATCTTTGATGCAATACGACCTTCTCTTGTTCAAAGCAGGACTGTATCCTGCAGATGTCCAGGCGTCCCTGCGCA
AATCCGCCGGAGAAAGCCTGTCTCAGATGCGACACAGCCATAGCGTAGACCAGATTTCTGGTGCTGCACTGCTCAGTATG
CAGAAGAACTACCCGGGTGTTTTTAGCTCTGATAACGTACTAGAAACATGGTTCTCTAGCAAGTACGGGGCCGATGTCGT
TGTCGTCAAGCCTGTGGCAGAGATTCAAGGCTTGGAGTTGGGTTTTCAGCGCGCTTCCAGGCCAAATGGTAGCGACGCGC
CTACTTGGGATTTCGGAAAGGACGAGAGTGATATTAAGAAAACGGCATAATTATAAGCAGGTATCACTAAAATCAGAAGT
GTCTAAAAAAAGTAACGAGACATGCAGATTGTGTATCATGTACAGAATACCTGGGCACCAATGGACGCTCCGAACGCATT
ACGTACGATGAGGTACACCCCACGTATCAATGGAAACCCCAGACCAAAGCAAGTGCCGTAGAAGAGATGATGAGACCCGC
CGGGGCCCCGCCATCAAACCGGTGGTTGGGTATCATACCATGTACTGTACTATCCGATCCGAAGGACTAGCTCAGTTTGC
TTCCGACAATCGTGCTATACCGGCAACAGCAAGCCGTGCAGTCTCATGACTCCCCACAATAGCTTTACAAGCCGGGGTGC
ACCTTTCTACTATAGAAAAAGTCAATTAACCCACGCCAATTCAAAACTTCTGATTCATCAGCAGGGACTAACATCTTGGC
CACACAAACGAAACATATTCTATCATGACTCTCACAAAAGACAGCAAAGACATCAGCAATGGTGCTATTGGCGCTGAAAA
AGTAGGGGGCACTCTTGGCCAGGAGTTCACAGAACATGTCATCCATGCAATGGGCCCGAAGACGAACCCCAGACTGCGCC
AAGTGATGTCCTCGTTCATCCAACATATTCATGACTTTGCTCGTGAGGTGCAGCTCACTACGGATGAGTGGATGCTTGCC
GTGCAAGTGTTGAACGAAGCTGGCAAAATGAGCAATGAAAAGCGAAATGAGGGACAGCTAGTGTGCGATGTGATCGGGCT
GGAATCGTGAGTCAAACTGACCTGTTGCCTACCAATACAACTACTGATACGTAATAGATTGGTGGATGATATTACATACC
AGCAGGCGGTTCGGACAGCACAGCCATTGACACAAACCGCCATTCTGGGACCGTTTTGGCGCAGCGACACGCCTGTTCGC
GAAAACGGCACAACAATCTCTTTCAACACTCCGAAAGATGGAAAGACGGCTTACATGTTTGGGAAAATCACCAGCGCCGA
TACTGGAAAGGGCATACCCAATGCAGTTGTGGATGTGTGGCAGGCTTCCACCAATGGTGAGACATGTGATGACTTGACGG
TCGTAACTCAACTAATTGTTTCCCAAATGTCTCAGGCTTATATGAACAACAAGACGACGATCAGTGCGAGCACAACCTAC
GAGGAAAGTTTATCACCGATGCCGAAGGGAGATATTCCTTCTACTGCCTGCGACCGACGCCATACCCTGTAGGTTGACTT
CATCGCCAAGCATTCGTATTCAGGCTACAAGGAAAGAAACTAACGAAAGAATAGGTTCCCAATGACGGACCAGCAGGAAA
GCTGTTGGACATGCTCGATCGTCACCCATGGCGACCAGCCCACATACATTTTATTGTAAGAAGTCTTGCCATGCACTGTA
TTTTACAAAATAGATTCTCACATATAACAGGTCGAGGCAAAGGGCCACAAGTCTCTTACTACACAAATTTTCGACTCAGA
GTCGAAATACCTTTCTGATGACTCCGTTTTTGCGGTGAAAGATGGGCTGACGGTTGATTTCAAGCCGCGCAAGAATGACC
CGAAAGCTTCCTTTGAGGTGGAATACAATGTAGCTCTTGGTTGAAGCGTGTACGAAATGGTTGGGGATGGATTACAGTTG
TGTACTAACTGAAATGAAAGCTTATTCACTACGTGACAGATTACTTGAAGAGATCCCTACTTAAATAAAGATCGCATACG
GAGTCCAAAGGGCTTATTTTAATTGCAATAACCATTCTGCCCTTGCAGTAATAACGCCGTTGCTCGAATCCGACCTCACC
CCGGTCATTCTGTGTCGTATGGGTATACGGAATAGGGATTGATTCTGACTTGCCGTTGTAGCTTTAGTGAAGAACAGTGT
GAACTCCAGTAAACCCCATGCCCTTCGCGTCACGTTTTAAGTGGCAAGGGTATAGAGTACTATGTACGGTGAACACGACG
CGGCGCGTAAAAGTTGTCCGGCTTTACCTCACCACAAACAACGATAGTGTCCGGCGCTACATAGAATTGTTAGTCGATTC
TAGTCATGGCCACTCCACAATATACGTATAGCCATTGGCAAAGACTGAAGTCGGAGCCGGATCACATCGTGGAGATATCT
GACCATACTGCCCACCTCGTGCTGATTGCACTCTGCAAGGATCCGGGAACCAGGCAAGATGCCATGAAAGTTATCGCAAA
CTTTGATGTCGCTGAACAGAATCGGCCGCTATCGGAAAATAGCACCTGCAGTACGAAGCGCAAAGTGAGGGACGATGACG
TTATGGTTTGCGAGCAATGCACAAAAATCTACACTGAAGACGAGAACTCGGACACTGCTTGTAATTTTCACAGCGGTATG
TAGCTTAATAAGGCAGAGTTTAGAGTGGGTGAAGAGTTGTGCTAATGCAGAATTAACCCAGGCCAGTTGGAGCCAGACTA
CGATGGCGAAGTCTGGTGCGACCACGACGAGGACAGTCACGGCATCATCGACAGCGACGAGCTGCGCCGCGAATACCCTG
AAGGCTACATTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62