GenePrediction:GLEAN_2307 Details

Name: GLEAN_2307
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:350059..351195 (+ strand)
Length: 1137
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:350059..350235 (+ strand)
Length: 177
Type: CDS
Source: GLEAN
Position: GCSC_140:350287..351195 (+ strand)
Length: 909
>GLEAN_2307 class=GenePrediction position=GCSC_140:350059..351195 (+ strand)
ATGAGCGCTGCAACCGACTACACCTTCCAGGGCTGGGTGGCCCTGGACAAGAACTCTACGGGCAACCTGGAATGGCAGAC
GTTTGAGCCCAAGGCCTGGGAGGAGACGGACGTCGACATCAAGATCACCCACTGCGGCATCTGTGGCTCCGATCTGCACA
CGCTTCGCAGCGGCTGGGTGCGTAGGCCTTTTTTGTCTTGCATCCTGCCATCCTGCTAACACGTACAGGGCCCGACAAAG
TACCCGTGTGTGGTAGGCCACGAGATTGTCGGCACGGCCGTGCGCGTAGGCTCTGAGGTGAAGCACATCAAAGTCGGCGA
CCGCGTCGGCGTGGGCGCGCAAGCGGACTCGTGCCGCAACCGTAAGGGGTCCTGCCGGGCTTGTTCGACCGGCCGCGAAA
ATCTCTGCGGCACACATGTGGGCACCTACAACTCGGTCTTCTACAACGGCGGCAAGTCCTACGGCGGCTATGCTGACTAC
AACCGCTCTCCGGGCCACTTTGTCATCCCCATCCCCGATGGCGTCACCTCGTCCAATGCGGCGTCTATGATGTGCGGCGG
TGTCACCGTCTTCACGCCTCTCAAGAACAGCGGCTGCGGCCCGGGAAAGCGCGTCGGTGTCATCGGTGTCGGTGGCCTAG
GCCATTTTGCCATTCTCTGGGCCAAGGCCATGGGCGCCGACCGCGTCGTCGGCATCTCGCGCCGCAACGACAAGCGCGCC
GATGTGCTCAAGCTCGGTGCCGATGAGTACATTGCCGTCGCCGAGGAAGCCGACTGGGCCAAGACCCATGCCTCCAGCCT
CGACATCATCGTCTGCACCGTCGCCTCGACCGATATGCCTCTGCGCGAGTACTTGGCCCTGCTTGACATCGACGGCCGCT
TCGTCCAGGTCGGCATCCCGGAGGGCCTGATGCCCCCCATCGCCGCTACTGATCTCGTCCTGAAGAATGTGTCGATCGGG
GGCGGCATGATCGGGTCGCCCGCCGACATCCGCGATATGCTGCAGCTGGCTGTCGACAAGAACGTCCAGCCCTGGATCGA
GGAGCGCCCCATGGATGAGGTCAACCAGGCTATCCTCGACATGGACAAAGGCCTCGCCCGATACCGCTATACCCTCGTTA
ACGAGAAGCACCTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62