GenePrediction:GLEAN_2308 Details

Name: GLEAN_2308
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:352992..357307 (+ strand)
Length: 4316
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:352992..354184 (+ strand)
Length: 1193
Type: CDS
Source: GLEAN
Position: GCSC_140:354298..354323 (+ strand)
Length: 26
Type: CDS
Source: GLEAN
Position: GCSC_140:354394..354504 (+ strand)
Length: 111
Type: CDS
Source: GLEAN
Position: GCSC_140:354706..354832 (+ strand)
Length: 127
Type: CDS
Source: GLEAN
Position: GCSC_140:354891..354962 (+ strand)
Length: 72
Type: CDS
Source: GLEAN
Position: GCSC_140:355065..355856 (+ strand)
Length: 792
Type: CDS
Source: GLEAN
Position: GCSC_140:355921..356207 (+ strand)
Length: 287
Type: CDS
Source: GLEAN
Position: GCSC_140:356280..357307 (+ strand)
Length: 1028
>GLEAN_2308 class=GenePrediction position=GCSC_140:352992..357307 (+ strand)
ATGATGCCCTGGATGCGCAAGAAGACCACCTCGTTTCCCAAGGATGAGGCCAACCAAATATACGTCTCTGATTTCTCCTT
ACGGACACAGCGCCAGGACGTGTCGAAGAAGCCGGCAACGGCCAATTTCGGCTCACCCAATGCGCGACCAATGGGCCCGG
AGGACGCCGAGGTGACGATTCCCAGCCAGATGTACTACAATTTGCTGCAGGAGGTGGGGGAGGCCGACAAGGTTGCCAAG
GTGATCGAGCGCACGCTTGCGGCGTCGGACCGGACGATGGACGATGTGATGCGCGGCGACCAGACCGGCTGCATTCTGGT
GGTGATGACCGAGAGCGAGCAGCAGGCGTGGCGGCAGCTGAAACACGTGTCGTGCGCAACAGGCGAGGTGGACTGCCTGT
ACGCGATGCGGGAGTCGCTGGCGGGAGTGGCACGGGTGGCGAAGCAGCTGGAGCTACGCTTCGACGCACCAGCTGACGAG
GGCGTGCGCCAACAGAACGCTTTTGAGCGGCTGGCCTACGAGGCGGAGCACTGCAACGGACGGGACAAGCGAGACGCACA
CAAGGACAGCAAGAATGGCGGCAGTCGGGCACTGGCGAATCTAAACCGCGAGGCTGAGGCGCTGCTGCACCGGATGCGGG
CACTTCTCAGCAAGGCCGAGGCGGGTGTGGTGCCGTTCTGCCGCCATGTGATGGATCTGGGGGCTGTCTGCACGGAGGGG
GACGACGACATGGACGAGCTGACGGCGCTGGACGTCGTCCGGGGGAGCAGCGTGATGACTCTGCTGGACAGCACATTGCG
TCGCATGTCGTCATTAGACCGTGTCAATGCGGTCGACCTTGCCCGCACGACCTGGTCACGCTGCGATGCCCGGATGCGCA
ACGGACTCGGCGACGAACCTCGGGCGGCTGACGGCCAGCCCGCCAGTCTGCTACGACGCTGGCTCCGACTTTCTGGCTCG
CGCGAATTCCACCACGAACAGGTCCGGCTTGCGCGCGGCCTGCAGGCCCAGGCACAGGCGGCCGGGTGCTGCCGGCGCTG
CCGTCCGTCCTCGACCGAGACGTCCAGCCCACAGAAGCCCCAGGCGACGAGCTCGTCTCGCAGATCGGAACCGAAAATCG
AGCGGGTGAGCAGCAGTCCCGGTCGCAATGCTGTCCGCAGTCGCCGGCCGGACGCGCCGAAAGTGACGTGGAAGTAAGCA
CGAGTGTCTTGGTTTTCTTTGTCTTGGTTCTGCTTGTCCTATTCCTTCTGCATGCTAACATCCAATCAACCGCTACTTTA
CTAACTTGAGCTTTGTTGCCTTTCAGTCGAATTATTCTTTATGTTCTTCTCTGTGAGTCTTGCATGCTGTAACGTAATGA
TATATATGCCCTGCCACTGATACGGCTGTCTCGGTGCCGAAGATCAGATGGTTGTGTCAGGAAATGCCCAGATGGGAATA
CTCACTGTTTGTCAGCCGGCCGGAATTTGGCTCAAAGTCCGGTGCTACATGTGGGGCCTCTCGACGTCGCGGAGTAAGCA
CGGTCAAATCGATCACCGCCGTGCTGCCATCATGCAAATCGGCAACTATCATGCAGAAAGGGTGGAACCACGGCTGCGTC
TAGATGCCACTATTTGGCTGAATGTGCGCGAGTCAAAAAGTCCGTCGGACTCTTTACGGAAAAAAGACCTGCAGTAACGG
GCAGAGAAGCTGGGTACATCCGCACATGAAGCAGAAGCAGCAGCCCTGATGGACGAAAAGGCAAAGGCCACAGCCAAATG
GGGAGCCGCCTGCTCCGCCTGTGCGTCGGCCAAGGTCAAGTGCATTCGCTCTGTCGAAGATGCAAGCGCCAAGTGTGACA
GGTAAGAGACCGGCGTCGTTACTGTCTGTTCCTGCATGCTGACTGCCAACGTCCAACAGGTGTGAACGGCTCTTTAAGAA
CTGTGCCGTACAGGTGCACCGTGCGCGGAAGAAGCGCACCAGCAAGACGTCGTGAGTGGCACTCCCCTATTATATGCGTA
CTTTCTACTATCCCCGCCGGAGAGTTAGGATATAGGGCAAAATCCCGGATTGACAGCAACTGACGTGGGCTAGCAAAACG
GCCCAGCTTGAAGAACGCCTTAACGGCCTGGTGGACCTGCTCCGGGCCTCTGGTGACCTGCTCCGGGCCTCTGGTGACCT
CAACACGTTGCATGCGGCCGAGGCCTCGCCACACACCATCTTGGCCGACCCATCACGAAAGTCTGACCGTCTCTACCATG
CGGACACGACCGATGTCTCATCCCGGCCTCCGCCACAGGACGTCCAACAAGAGCAGCTGACTGCCCAGATTGCCATACCG
GTATCATACAACTCGTTTGCACCGCCGACATGCATCTGCCGCCCCGAATCTGGCGAGATCATCACGACTGCTGTCGACTC
GGATGAGGACCTGCTGAAAACGTACCGCTCGCTCGAGTACCCACACTACCCCTTTGTGGCTGTGGCATCCGACGTGACGG
CTGAGCAGCTGATGGTCGAGCGGCCGATCCTCATGATGGCCATCCGCGCCGTCGCCTCGGTCGACAACAGTCGGTTCATG
CAGGGTGCCATGTACCGCCTGATCTGCCTGATCGCTGACCGCGTCATCCTGCAGTCCGATCGCTCGCTCGACCTCGTCCA
GGGCATGCTTGTCGTCGTCGGCTGGTACCAATACCACTGCATGATGCACGCCCAGCTCAACAACCTGCTGCACCTCGGCA
TCAGCATGATGGCCGACCTCGGCCTCAACCGGCCACCGCGTATCGCTGAGCGCACCCATATCTTGGTCCTGCACCCCAAC
ATCCCCAGTCCGCGCGCAAACGAGGAGCGCCGTCTGGTGCTGGGCTACTGGTATATGTCATCATGGTGGGTTTTCTTTTC
TTCTTTTCTGCTTTTTCCTTTCTCCCTTAACTTAAGCCTGATCACCCAGTCTGTCTCTTGGATTTCTTAAAATCGAGGCC
ATGCGCTTCTCGCCATACGTTCGGCAGTGTCTGGACGAGCTGGACGAGATCTCAGAGTATCCGTCAGACGCCCGTCTGGT
GACTATCGTCCGGTTGCAGCATCTGGCCGAGAAGGTTGCCAGGTTTAACAGGCCGGAGGAGCTGGGCGACGAGATTCCGG
GAATCTCACGGGCGCCCAGTTCTGCGTACCAGCTGGCCTTTCAGAACGAGCTCGACCGTCTGTGCCAGGCCTTGCCAGAG
GACATCAAGACAGACAGTACGTTTTCGGAGGAGCTTCAAGCCTTTGCATTCCACTCCACAAGCAAACCTGTTACTCATCA
TCTCCCAGAATTGATCCAAAATCAAATCAACACCATCAAACTCCGTCTTTACGAACCTCCTCTTTTAGATGCCACACTGC
TGCAGAAGTTCTCGGCCGACTTCACTGCCGTGTCGTCCAACAACCCAAGCGGCTTGGATATCCTGTACCGCTCATATAAT
GCCCTCCGCGGATGGTTCGACCAGTGGTTTACCATCCCCGTGTCGCAGTACCACTGGGTGCCCATCCCGCTCTGTGTGCA
GCTCGTCTATGGCATCACCATGCTGAGCCGTTGGGCGCGGCTGGTGGGCGCCATACGGCCAGCACACACCGACCTTCATG
ATTCGACCATCAACATGGCCACAGCCGTTCCGCCCTCATCGTCTTCCACCCTCAAGGACCCCAGCAGCCGGCTTGTGCCA
GGCCAGGGCGTTCCCGTATCCTCCTCATGTGCCCTACCGACCAGTTCGGTGGTCCAGCCTGCCGTCGCTGCTATTGCCGG
CCTCGATGGCAAGGAGATTGCCTGCGATCCGAAGCTCAAGGCGGCCATGGCCCAGATGCGGGACACACTGCGCAATCAGC
CCGGCCTGTTGATCGATATATCAGCCCTGCTCACTGCCCTTGGAGACCGCTTCGAGCAGTCCAACCTAGAGATGCGCGCG
GCAAGCGCGGCCAAGTTTGGCGACTCGGCCGACCGCGGCATGAACATCTGGGACCTAACGTCCCGCAAGATTGCCATCCT
GCGATCCAAGCTGGGCCCCTTCCTGGATGACGCAACCACCACCGAGATGACCACACAGCAACAGCAGCAACACAATCAGC
TAAATCACCATGCCGCTGCCGCCTTTCCTATCGAGGGCAGCGGCTTTCCCGTCGATCACAGCCTCGACGTCAACTTGGCC
AGTGGTATCGCTGATGCTGCGACAGATTCCGCCGGTCTGATGTCGACATCCATCGAGGGCTGGGACTGCAACAGTCCGTG
GGCCAACGAGATTTTTGAGGACATGGAAGCGAGCCTGTGGCTAGAAAGCCTTCCTTGGGTGCCCATAGGCGGATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62