GenePrediction:GLEAN_2309 Details

Name: GLEAN_2309
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:360118..360608 (+ strand)
Length: 491
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:360118..360334 (+ strand)
Length: 217
Type: CDS
Source: GLEAN
Position: GCSC_140:360394..360608 (+ strand)
Length: 215
>GLEAN_2309 class=GenePrediction position=GCSC_140:360118..360608 (+ strand)
ATGGGATCTCTTGTTATCCCGCAGCTCAAGGAGGCCTGGCATGTCGACCAGGCCATCCTCTCGGAAGCTGACCGCGTTGT
GGTCATCCGCTTCGGCAAAAATGGCAACCCCGATTGCATGCGTCAAGACGATGTGCTTGCGCGCATTGCACCAAAGGTGA
AAAACTTTGCTGTCATCTACATCTGCGACAACCAGAAGGTTTCCGATTTTAACGAAAGTGGGTTCTACCGATGCCGTCCC
CCACCCGCAGCTCTGTTTTCTGACGGATTGCATTAGTGTACGAGCTCTATGATCCATGCACCATCATGTTCTTCTGGCGC
AACAAGCACATGATGATCGATCTTGGCACTGGCGATAACAACAAGATCAAGTGGGTAATTGAGGACAAGCAAGAACTCAT
AGATATTATCGAGACCGTCTACCGTGGTGCCAAGAAGGGTCGTGGCTTGGTTGTCAGCCCAAAGGACTACTCGACCCGCC
ATCGGTACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62