GenePrediction:GLEAN_2337 Details

Name: GLEAN_2337
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:505257..509793 (+ strand)
Length: 4537
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:505257..505589 (+ strand)
Length: 333
Type: CDS
Source: GLEAN
Position: GCSC_140:505706..505772 (+ strand)
Length: 67
Type: CDS
Source: GLEAN
Position: GCSC_140:506156..509793 (+ strand)
Length: 3638
>GLEAN_2337 class=GenePrediction position=GCSC_140:505257..509793 (+ strand)
ATGGAGGTCGCCGTTGGGCAGGTGATCCTGCTTGGCGATGGCCGGCGAGGCACGATCCGGTTTGTCGGGCAGACGCTCTT
TGCGCCGGGCGACTGGGTGGGCGTGGAGCTGGAGACGACGACGGGCAAGAACAATGGCAGCGTGCAGGGCGAGCGATATT
TCGACTGTGCAATGGGCCGGGGCATGTTTCTGCGTCCGAGTGCGGTAACGATTGTGGCGGTAGCGTCTGATGCGGATGAC
GACGACGAAGGGACAGACGACGCCCACGAGGGCGAAGAGACACAGACAGCCGTGCAAGTACCCAAATCGGTATCGGCAGC
ACGGCACTCGTCGGTAGGCTCGGCAGGCGGTGGCCGGAGGACGGCAACGGGAAACCGGCCAAGCGGCGTGTTTGCGTCAG
GGCCGGGCAGCCGAACAAGCGGAATTGGGGCGGATGCTGGACTGGCCAGGCGGATGAGCATGAACGCGCCCAGTCCCAGC
CCGCGGCCACGATCTCGGCCGACGAGCATTACGAGGGTGTGTATTTCGTAGAGCGTGCCTTGTGCTCCCGATTGCACCAC
GAGCCTCTTGACTGACTGGCTTCACTTGCGCGGATCAGCAGGCATCACCGACAAAACAATTGGGCACAGCCCCACCGTCT
CGTACGACGACTCCTTCCAATGCCGGCCCCGGCCGTCCTCCGTCGACCAGCATCAGCCGGGCCGGCCGGGTATCGATGGG
GACGTCGCGTACGTCGATGGGTCCACCGTCAGTGCCGACGTCACGAGCAGCCACACGCACATCGATGGCGCCAACGGCAG
GGACGGCTACGCCGCGGTCGGTAAGCGGGACACCAGGCCGCATGACGAGTGGTAGGGCAAGCGGGCTGGGAGGAGCTATG
GGAGGAACTGTGGGAGCAGCACATCCCAGGATGCGAAGCTCGAGCCGAGCAGCATCGGGCGAATTCGGTGGCGAGAGCAG
CGGCGGCGGGGTGGTGGCTCGTGCGGCTCAGGTACGCAGAGCACGGACGAGTATGGACGGGCGGATCACGTCTCCGCCGA
AGAGCAGCGACGAAGAGGTGCTGTCCCCGCAGCCTCGGAGCCCGGTGCGGACGCGGGCAGCGGCGCTGGAGAAGCTCACA
GGGTCTGGGGCGGGAGCAACGCCACGGCACCGAGCGGCGGCACCGGTCGGAGGATCGACGGCGGGAGCGACAGGGTCACC
GGCATCAGCATCAGCATCAGCAGCAGCAGCAGTAGCAGCAGCAGGGACGGGACGGCCTACGACGACAAACGCGGCAGCCC
ACCGGGAGGTGGAGGACCTGAAGGCGAAGCTGCGGGTGCTGGAGCGGAAGCGACTGGAAGACCGGGATAAGCTTAAGCAG
CTGGACAAGCTGCAGGCGGACTGCGACAAGTACCAGGGAATCATCCAGAAGATCCAGGCCAAGTACCAGCCGCAGCAGCA
GGAGAACGCGGAGCTGCGGCGGCAGCTGAAGGAGGCGGAGACGCGGATGGAATCGATCGAGACGCTGCAGGCGGACCACG
ACACGGCGATGGAGCTGTCGACGCTGGACCGGGAGATGGCAGAGGAGACGGCAGAAGTATACAAGGCGGAGCTGGACGCG
GTGAAGCTGAAGAACGAAGAGCTGGAGGTGGAGATGGAGGAGCTGCGGCTGGAGAACGCGGAGATGTCGGAGGGGATGAC
GGCGGAGGAGAAGGCGAGTGCGGGATGGCTGCAGATGGAACGCAACAACGAGCGGCTGCGGTCGGCGCTGCTGCGACTAC
GAGATATGACACAACAGCAGGAGTCGGAGCTGCAGGACCAGATCAAAGGACTGGAGGAGGAGGTGACGGAGCTTTCGGGG
ATCAAGGCGCGACAGGCAGCGACGGCGGCACGACTGGAACAGAGCGAGGCGGCGGTGGAGGACCTGCGACAGCAGCTGGA
CGCGGCACAGGCGGCGGACGACATGATGATGGAACTAACGGAGCGCAACATGAGCCAAGCGGAACAGATGGAGGAGCTGA
AGGCAGTAATCTCGGATCTGGAGAGCCTGAAGGAGATCAACGACGAGCTGGAGATCAATCACGTACAGAACGAGCGGGAG
CTGCAGGAGGAGATCGACTTCAAGGCAGCAGTGATACAGGAGCAGGCACGACGGGCGGCACAACAGGAGGAGGCACTGGA
GGACATGGAGTACGCGCTCTCACGCTTCCGGCAGATGGTGACGGGGCTGCAGAGCGACCTAGAGGACATGCGGGCGTCTC
ACGCGGTGACGGAAAACGAGTCAGAGCAGCTGAGCAGCAAGTCGCGGGCGATGATGGACCTGAACCTGAAGCTGCAGCTG
TCGGCGGCGAAGGCGCAGGTGAAGACGATCGACCTAGAGCTGCGGCGGATGGAGGCGCAGGAGGCAGAGCAGCACCTGGC
GATTGTGCGGCTGTTCTTGCCGGAGACGTATGTGGAGACAGACGGCAAGGCCGTGCTGGCACTGCTGCGATTCCGGCGGC
TGGCCTTCAAGGCGGAGCTGGTCGGAGGATTTGTGCGAGAGCGGATCGGCCAACAAGGAGGAGGAGGGGAAGCAGCAGGC
CGAGAAGACGACGTGTTGGCGGGCTGCGAAGTGGTGGACAAGCTGACGTGGGTGGCGGCCATGTGCACGCGATTTGCGGG
AGCGATGGGACGGTGCTCGACAGAGCGATTCGGCCGGTTTGAAGGGGCTCTGTTTGAGCTGGAGCCGGTGGAGCGAGCGC
TGAACGGATGGATCGACGGGCTGCGACGAGACGAGCTGAAGGAGCAGACGTGCGCGGCGGAGCTGCAGCGAACAATGGCG
TTGCTGTCACACCTGGCGTCGGTGCACATGGAAGAGGGCCAAGGACAGCAGCAGGAAGACGTGGCGGAAGGGATGCACAT
GCGAGCAGTTCTGGTGCAGAGCCATCTGGAGACAGCAGCAGCGACGTTGCACGTGACCAGGGGAATGGTGCAGCGAGCAG
TGCCTCCACGGGGAAGCGAAGACGAGGCGGCGCAGGAATTTGCGCAGCGGGCGGAGGCAGCGATTGCACAGACACGCAGT
GCCAAGGTGGTAGCAGGCAAGATGGTACGGGCGTTGGAAGAGCTGCAGACGCGATCGCTGGCGCTGGAGCCGGAGATGGC
AGAGGCGTTTGCGCAGTGCGAAGCAGCAGCAGGCGAGTTGGCGACTCTGGCCCGAAAGACAGGCGAGGCCGTGATGGAGG
TGGTGACGAGGGAAGGGGGACATCGACGAGACGAGACAGGCGAACAGCAACACGACGACGAGGAGCAACACGACAGCAGC
GGGCCAACATACGGAGACATGCAGAAGGTAGTGGCAGCAGCCGAAGGCGAGACAGCATCGGATTCGGGCGAGCTGTTTGG
CGGCTACATCGGGCGGCTGCGGGCAGTGGCGACACAGGTGGCCGAGCTGGCCGGACTGTCAAGCGACCTGTCACAGACGG
TGGAGTTTGAGCGAGCAGCAGCGCCATGGGTAGTGCGCAGTCAGGAGATGAGGGCGCCGAAGACGGTGGCAGTGGATGCA
GAGGAAGAGCTGCGGCGGCTGCGCGAGGAGCACGCAGAGGCACGACGGATGATTGCACGACGCGACAACGACCTGGGGAC
GGCGCAGCTGAAGATCGAGACGCTGGAGAGCAAGATGCGCGATGCGCAGCACAAGGCAGCCGTGATGGCCGAGCTGGAGC
GCACGGTAGCGGCCGAACAGGCATTTGGGCGCCAGCTCAAGGAGGATGTGCAGAAGCAGGACCGCGAGCTGAAGGCGCTG
GAGGCGGAGCGAGACCGGTGGCGAAAGATGGCGAGCGAGGTCCGGCTGCTGGGAGGAGGAGAAGGAGAGGAGGAGGAGGA
AGGAATGGAAGGAATGGAGGGACTCGAAGGAGGCGAAGGACTCGAGCGAGACATTGGTCACGGCCACCGCGCCAACACGC
GGCTCACGCAGCGCAACAAGGAGCGTGCAGCGGCGACGGCGCGCGAGATGGACGGTCTACGCCACGAGATCGCCGGGCTG
CAGGCGGCCGTCCGGTTTCTGCGTGAGGATAGCCGGCGTGCCCGCATGGCCGAACAGCCGGTATATGGCTGGCTGGCCGA
GCCACTTTCATCACGTGGTGGCGCCACAAGCACAGCCACACGCACAGCCACAAAGGCGGCTCGTCGTGCGCGCGTCGCTG
CCGAGGCCCGCGACGTTCTCGGCGAGCTCGTCCGCATGGCTGCCGATGCGCGGGTCTACGATCTCGAGGCTGAGCTGCCC
GAAGACCGGCTCGCGTGGCGGCCTGCCCACACGTCGCCCGGCTACCAGGCCGCCCGCATGGCCGAGGACTACGCGGCGTG
GCGCGCCTGGGAGGCGGCTGTCGTGCGCAAGGCGCAGGACGTGCTTCTGGAAGGAGGCGGCAGTCGTCATAATGCACAGG
CACAGACGCCGGACGAGAGGACGGCGCGGCGGCTGGCCCACAGAGCAGCCACGGTGCGGCTGCAGCAAACACGGCTGCCG
GCGGGCGAGGTCGACAAGACCGACGCAGACGGTCAAGTCCGGATTGCCAGCTGCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62