GenePrediction:GLEAN_2338 Details

Name: GLEAN_2338
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:520838..521908 (+ strand)
Length: 1071
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:520838..521003 (+ strand)
Length: 166
Type: CDS
Source: GLEAN
Position: GCSC_140:521066..521442 (+ strand)
Length: 377
Type: CDS
Source: GLEAN
Position: GCSC_140:521504..521908 (+ strand)
Length: 405
>GLEAN_2338 class=GenePrediction position=GCSC_140:520838..521908 (+ strand)
ATGTCGGGCGCACGAACACGAAAACAGGCAGCTGCTGCAGCAGCTGCTGCTGCTACCGCTGATGGTGCAGAGCCGCCAAA
GACCAATGGCCACCTCACCACGACGGCCAAGGACGAGGACGACTACCCACACGAGAACATCTTTGTCTTCTGGCCCAACA
TCATCGGTAGGTCGATGTCGCAGACAGACGGATCTGTCTCGTGCCCCGCTAATCGCCTTGAATCGTAGGCTATTCCCGCA
TCGTCCTCGCTCTGTCCTCGCTCTACTATATGCCGCTTCACCCGCGCACCTGCTCGCTGCTGTACAGTGTCTCGTGTCTG
CTCGACGCCCTCGACGGCTATGCGGCGCGCTACTTTGAGCAGTCGACTCGGTTCGGCGCCGTGCTCGACATGGTGACCGA
TCGATGCACCACGGCGTGTCTGTTGGTCTTTCTGTCGACGGCGTTTCCGCGTTGGGCCATCGTGTTTCAGGGCCTCATTT
CGCTGGATCTGGCCAGCCACTACGTCCACATGTACGCGACCTTGGCCATGGGTGGTGCTGAGACGAGTCACAAGTCTGTC
GACCGATCGCGCAGCTGGTTGTTGAACTTGTATTATACGAACAAGGTGGGTTATCTTCTCTCTCCACTCCTCACCCCTCT
CTCCTCTCCTCCCACTAACCTCACAGACCGTCCTTTTCCTCTTCTGCGCCCTCAACGAACTCTTCTTCATCGCGCTCTAC
CTCCTGTCGTTCTCGTCGCCGATCCTATCGCCTTCGCTGCTCAAGCCGGTGGCCGACCCGTCGACCTTTGACACCGGCGT
CCAGGTCAACTCGTCGCTGTTGCGGCAGATCTTTGCCAACCCGCACAGCGCGGCCGCCCTGGAGATGGCCCGCGCCAACA
AGATGGACTCGTTCTGGCCCTGGGTCCTGGCTGGCATCAGCTTCCCCATCATGGCCGGTAAACAGCTGCTCAATGTCGTC
CAGCTGGTCAAAGCGTCCCGCTGGTTGGCCGAGGGCGACGTCGCCGCCCGCAGAGCTGCCGGCCTGCCGCGGCGCACAGC
CAAGACAACGAAGACCAAGAAGACCAACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62