GenePrediction:GLEAN_2341 Details

Name: GLEAN_2341
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:534991..539572 (+ strand)
Length: 4582
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:534991..535212 (+ strand)
Length: 222
Type: CDS
Source: GLEAN
Position: GCSC_140:535298..535318 (+ strand)
Length: 21
Type: CDS
Source: GLEAN
Position: GCSC_140:535397..535875 (+ strand)
Length: 479
Type: CDS
Source: GLEAN
Position: GCSC_140:536718..536931 (+ strand)
Length: 214
Type: CDS
Source: GLEAN
Position: GCSC_140:537092..538079 (+ strand)
Length: 988
Type: CDS
Source: GLEAN
Position: GCSC_140:538158..539572 (+ strand)
Length: 1415
>GLEAN_2341 class=GenePrediction position=GCSC_140:534991..539572 (+ strand)
ATGGACGAGATGCGTTTTCGCACCCAGCAGTCGTCTCGGAACGACACCTCAATGGGCTCTTTTGCCTCCCCCCCCCGAAA
CGGCTCCCGCATGCCGCAGCCTTCCGATTCCCGCTCCTCTCTGCCTCGCCGGTTTACAGCCGATTCGGGGCGTGTACCAA
CATTGTCCAATAATACAAACCAGCAGCGAGCCCCAGAGCCGCAAGATCTTTCCGCCACGACGGTTTGTGCCCCTCCTTTC
CTCGACCTCCACCCCCACATGCCCTATCCTACATACCACCGAAATGGAGGCTGACAGGCTGGTATAGGCATTGCACAAGG
TTCAACTGGTATGTATACCAGGACAGGAATCATGCCGCTTGTATGCTGCAAATATATTTTCCTAGGCTGACTCTCTTTGC
TCCCAGTTGGAGAAGAAGCGGTTAGAATACGAGAAGCTCCGCGAGCAGAAGCGGCGCTTCGAGGCCGAAATGCAGAAGCT
GGACCAACAGCAGCGGCGTGAGGAGCAGGAGCTCGCTGCCATGCAGGAGGACTTGGGCCGCATCGGTGCTTCTGGCGGTA
TGGCCCCCGGCCACCAATCCGAGCCCACCACGCCGCCGGAATACCGCGAATCCGCGTCCGGCTTCCCATCCATGTTCTCG
CGACCAAACCGCTACTCCACTTCGAGCCTGACCTCGCCACCAGGTCTCCTCTTCAACCGTCCGACACGTTCTGGCTCTCA
GATTGCCTCTCCTCAGTCTGGCATCATTCAGCCGTCACAGCAGCGGATCGCCTTTGATGACCAGCTTCCCTCTCGCTCTG
TTCCCGGATCGCGGCGCAATAGCGACGAAGACGAAAAGGAAGAGGCTGTCCGCCAGGACCCTACGAGCCACCGCTCTACC
AATGCGTAAGTCTAATCAACACGTGCCGCTAGTGTTCTACTATCTCCTTCGCTTGACTTTGATTTCGGCCTGCTTTGCAT
GGGAAGAGAAGCCTTTACCATTGTATGGCCTGGGTTACATGGCTTTCAAGGCTGTGGCTGCAAGTGTAGTCAACTTGCTT
TCCGTACTGTGGGCATTGGGCAGTGTCTTCTCAGCCTTTGTGCCATTATCAAGCATATGGCAGAAGCTGGTGTTTTTTTT
TTCATTCAAACTCGCCATCAACATCGGATCACTTTGCACATCACCACGTCTTTGCATCCCTCCGTCTATTGGAAGGGAGG
GTGACTACCTCGGCTTGACCCACTCATACCTATTGTCTCTGGACTTATGACTTCCCAAACCCTACAGCTTCATAGCTGCT
TACTCCTTACCCTATTCACATATCGTCTGGCCTCCATTGAGCATTCTTCTTCAATTGATTCAATGCACTGGCCCTGATTT
CAGGGTCTACGCTCTCACATTTCTAGAAGTATATTAGATTGCTTCGTCTTTATTTTCTTTGCTTTACCGTTTTCATCACT
TCTACTTCGTTTTCTGCCCTCCACACAGCCGCATCCTTTCTTCCTTTCCTGCATCTCTTCTATCAACCGTACCACCATCT
ATCTTGAAGGCTTCTACAGAGCCCATTGCCGTCAAAACGTCGTTTCCATCCGTCCTGGACATCTGTCCAAGCTATTCATC
ACCCCTGTTCAATTTCCGTCTTTTGCCTTGTTCTTTTGTCCATTGAGCAAATTTCTCAGCTCCCGTTCAAAATGCTTCAA
CGGCCGTCGACTCCCAATGGCAATTTGCCTGCTGACTCTCCATACAGCCTCAACCGGTACAGTATGCCTGTGACGAGATC
TAGATCGGGCTTTTACGACTTCTCCTCTCTTGACCAGACGAACACCACACGCTTCCTGTTTGGCGAGGACGAGGACCACA
GCAATGTTGAGGGAAAGCTCTACCAATCCAACAAACCGAAGCCTGTTGCGCTTGATGAGAACTTTCCCACTCTCACACGC
CGCGAGGGTCAGCCCCACATGGTATGTTTTGTGTGCTTTTTTTACAATTTTTTTCTCAATTGAGTTGCTGGATTGTCTCA
AACCCACTTCACGTTGCTTTCACTTGTTCAGTCCCAGTCCTTCCTTTCATAAGATAAGGGAGACAAGGTAGTCCAATTTA
CTGACAGGTGCCAAACATCAGCTCTCGGCTTCCTCTGCAGCGCTTGACCTGGCTTTGGCACAAATGGCCAACACTGAAAC
TGTTAACGCCAACGACTGGGTTGGTGTTAGCCGCCACCGCACTCAGCCAAGCCTGTCTGGGCTGAGTTCATCTCAGCGTA
ACAGTTCCATAACTGTCACATCCGGCCCGTCCAACCCATCAGATTCCACCACTGCCAGTGGTCGCCCTTCGTCAATCCGG
CACTCATTTGACATGAAGTACTATACGGACAATGTGTCTGAAGTCTCTGCTTCGATTATGTCTTCACCCACAAGCCATAT
CCTCGCGACGCCACCCAAGCTGCAGTCGTCTTACTCTGCAAACGACGTTTCGACCATCAAGACAACTCCCGGCTCTAATG
TCTCGTCGAACACGAACAACCATGCTCAGCAGTACCTGCACAACCACAATGCTAGCCTTGGCCGCATCCCGGCTGGTGCC
ATGCACAACCGCCACAGCCGGGAGCTGTCTAGTGGCGACCTCAATGGTTCTATGGTCGCTCGTGAGTTTGCTTCCATTGG
GTCGGCTCTGCATGCCAACGCAGCACCCTTTGGCTCTGGCACTATGACTCCCAACGGAATGCCTCAAAGCTCATCTTCCA
TCCCAGCTGCAACTCTGGCAGCAGCAGCAACCGCAGCCGCCGCTGCCGCCTCGTCTGGTTCCGCGACGACGTTACCCCCC
ACCACAGCCGGCAATCAGTACATGGCTGGATACTATGGCGCCCCCAATTATGCCGTACAGGCCAACGGCGTAGCACCCAT
TCCTGGACCTTCACCATACGGCGGTCCCAACGGGTTGCAAGCTCTCACACAAACGATGCAGGCTATGTCGATGAACGGAG
CCGGGCCTATGTATCAACCTCAGGGCTACAATGGCTACCCATCCCTTTACGGCATGCCAGGAGCCCAGCCCCAGATTCGA
GACAGCCAGGCCCGTGTCATACAGAGTCGCCGACAGGTGGACAACGAAGGTGAGTCTTTTCCTCTGCTTATTCGTGCATC
TATGCCTACATGGGCCGCCAAATCACGTACTGACTGTTCATATATAGCCATGAACCGTTACAACAACACTCCTCTTGAGG
CAGTGGGCGGAACGATCTACGAGCTATGCAAGGATCAGCATGGATGCCGGTACCTACAGAAGCAGCTGGAAAACCGCAAT
CCTGAGCAGGTTCATATGATCTGGCTTGAAACGAACCAGCATGTGGTCGAGTTGATGACCGACCCCTTTGGCAACTACCT
CTGTCAGAAGCTGCTCGAGTACTGCAACGATGACGAGCGCACCGTCCTGATCCAAAATGCAGCCCAGGACATGGTGCGCA
TTGCGCTCAACCAGCATGGCACGCGTGCTCTTCAGAAGATGATCGAATTTATCTCGACCGAGGCTCAGGTTCAGATCATT
ATCGAGGCTCTTCGCCACTGCGTGGTCGATCTTATCAAGGATCTGAACGGCAATCACGTTATCCAGAAATGTCTCAACAA
GCTCACCCCCGCCAATGCGCAGTTCATTTTTGATGCCGTTGGTGGCGCTTGCGTTGAAGTCGGCACTCACCGTCACGGCT
GCTGTGTCCTGCAGCGATGCATTGACCATGCTTCAGGGGATCAGAAGGTCTGGCTCATCCAGCGCATCACGGAAGAAGCA
GTGACTCTCATTCAGGACCCGTACGGAAACTACGTCGTCCAGTACATCATTGATCTGAACGATCTCAACTTTACTGAGCC
GCTAGTCGCCCGTTTCCGTGGCCGCATCTGCTCACTTTCACGACACAAGTTCAGTTCCAACGTGGTCGAAAAATGTCTCC
GCTGTTCCCTGGAACCTTCTAGGGATATGATCGTCGAGGAGGTCCTGAACTCCGGAGAGGTCGAACGCCTTGTGCGTGAT
TCGTATGCGAATTACGTTGTCCAGACCGCCCTTGAGTACGCCACGCCGTACATGAAGGCTCGCCTGGTCGATTCGATTCG
CCCATTCCTGGCTCAGATTCGGTCGACACCGCATGGCCGTCGCATCCAGGCCAAGATCCAGGCCTACGACTCGCGCAGTG
GCCAGTCTAGTGGACACATCACTCCGGCGGACTCGTCTCAGGGTCAGATCCCGCTTCACACCAGCCACAGTCGCAGCGGC
AGCACATCGATGATGGTGCCGACATCAGTCTTTTCCACAAACGGGCTAAATGGCATCACACACCGTGCTGGAGTCAACGG
TGTTGCTGGGCCGGCCGCTACAGGAAATCCCTCTGGTCAGGTCAACATTCTTGGTGGGTCCCAGGGCCGTTCGATGCCCC
AATACGCCCCGCCGCAGTTTGCGCGCTCGACCATGCCAGTCAGCGGAGTGCCCACGACTGTTGCGATGATGCCTTCCATG
GTGCCCGTCAGCATGGCGCCGAACATGGCTGCTGGCCTTCCGGGCATGCCCGGGCCTGGAATGGGCCTCATGAACGAGAA
TGGTGAGACCGCATGGCTATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62