GenePrediction:GLEAN_2342 Details

Name: GLEAN_2342
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:543132..544204 (+ strand)
Length: 1073
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:543132..543191 (+ strand)
Length: 60
Type: CDS
Source: GLEAN
Position: GCSC_140:543376..543876 (+ strand)
Length: 501
Type: CDS
Source: GLEAN
Position: GCSC_140:543934..543955 (+ strand)
Length: 22
Type: CDS
Source: GLEAN
Position: GCSC_140:544038..544204 (+ strand)
Length: 167
>GLEAN_2342 class=GenePrediction position=GCSC_140:543132..544204 (+ strand)
ATGGCTCCGAAACGTGTTCTTTGCGGCTACGGCATTGACGTCGATGCCGTGGCGAACTGGGTATATATGCGCATTTGACA
GAGCTTTGCTGCCCTTGACAGGCTGCATGCATACTGACGGTGAAGGGAGCCTGCCAGATCAACACCTGTGACGGTTCAAA
GCAAACCCGCACAAACGTCTCGCGCGGTATCTATGGAGCGACGGTGGGCATCGACCGGCTGCTGAAGCTGTTTGGCAAGT
ACAGCATCAAGGCAGCTGGTTTATGCCGGCACACAGCATCGAGTCGTTTCTGGCCCAGCTGACCAAGGTGCGAGATGCCG
GCCATGAGATCGGCCTGCACGGCTACACGCACGAGTATCCGTCGGACCTGAGCGAGGTGCAGCAGCGTGACGTGCTGGAG
AAGTCGATCAAGGTGATGACCCGCTTCTGTGGCGGCAAGAAGCCGGTGGGATACACGGCGCCCGCCTGGGCGACGAGCAA
GGAGCTCATCCCACATCTCGAGGAATACGGCATTATCTACGATCATTCCTTCATGCACCACGACTTCCAGATGTATTTCT
GCCCCGACAGCAGCCACGACTGGGTCGAGACCAACTGTGCTCACGATGCCTCCACCTGGATGCGGCCCATGTCCAAGGTG
AAGCCGTCGCAGGTGGTCGAGATCCCGGCCAACTGGCACCTGGACGACTGGCCGCCCTTGCAGCCGATCCTCGGCAAGCC
CAGCCACGAATACATCGATACCGAGGTCATCTTTAGCCTCTAGAAGCAGCAGTTTGACTTTGCCTACCTTGAATACGACC
AGTTCATCTTTCCCATCTCCATCCGTACGTGCTCTCGAGTCCTGCAGGGTGGACTGTCTCGTTGCGTGAGAACTGTAAGG
CTGACCAGCGACATGCGTCATCGCAGACCCCCAGATCAGCGGGAAGCCCCACGTGGTCCTGCTGCACGAGCAGATGATCA
AGTATATCAACTCGTTCGAGGGCGTCGAGTGGATGACCATGGCTGAGATGGCGCAGGAGTTCCTGCAGGGGAGAATTACT
GGCGCCGCCGTCGAGGGCGGAGTAGACCTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62