GenePrediction:GLEAN_2365 Details

Name: GLEAN_2365
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:697570..699683 (+ strand)
Length: 2114
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:697570..697644 (+ strand)
Length: 75
Type: CDS
Source: GLEAN
Position: GCSC_140:697698..698074 (+ strand)
Length: 377
Type: CDS
Source: GLEAN
Position: GCSC_140:698124..698768 (+ strand)
Length: 645
Type: CDS
Source: GLEAN
Position: GCSC_140:699044..699683 (+ strand)
Length: 640
>GLEAN_2365 class=GenePrediction position=GCSC_140:697570..699683 (+ strand)
ATGCCGCTCATCGACCGTGTCTACAGCCTGGGTCTCTTGATCGACACCGAGCCTCCGACGCCCAAGACCCCAAAGGTGAG
CGTCTGAGATGAAGTGCTACGTTTCAGTTCCTTGCTCACCTTTTGCAGATCATGCCCAATGTTCGGCCAAAGCCAGCCGA
AAAGGCGCCTGGCGATGCCAGTCCGTCTGCCGTAGAGGGCAGCAGCACGTCGACCGAGGAGGCGGATCTCACCAGCGATT
GCGAGACGCTATCCTCAGTCGACAGCGATAGTGCGTGCGACAGCATCCACGACAGCGAGGACGACGACAGCGACTGGGCC
GTGAAGACGCCGAAGCGCATCGACCACGTGGCCGAACAGGGCCGGGCAGAGAAGTGTCGACGACAGTCTCGCTCGTCCGG
ACGATTCCACGAGCTCAAACAGGCGGCTGTCGACGAAGACGCATCTGCCGGGTTCCGACTTTGTGGATTCAGCAACGGCA
AGCGGGTTTACCGTCTTGAGTCGCCGTAGGTGATGCCATGGAGAGTGTGCGAGTCCTGTTTCTGACCAGATCAGATACAC
GAAGAAGCTGCGCGACTCGACGGTCCGGACGGCCGTCGGGCTCTGCTACATGAATCTTGCGGCCGTCTGTCCGCCAGCCG
TGGTGGAGGTGCCGAGCAGCGAGGATGACAAGGTCAAGCACGTCAACGGCGCCTTTGCGATCCGGCCGTCCGCGCTGGGC
GGTCTGGGGGCGTTTGCGCTGCGCGACCTCGCACGCGGCGAGCACATCCTGGTGGAACGGCCTCTGCTGCGGACCGACTG
CTTTCACCTGTGCGCCGAGCTGGAGCGGCTGTCTGCGCCACAGCGGGCGGCGTTCTACGCGCTGGCCGGCCACCATCCGG
ACACGCGAGCATCGGCAGCCGAGCGCATCTGGACGGCCAACACGTTTATGGCTGGCACGCTCGAGGGCGTCTTTCTGCTG
GCGTCGCGCTTCAATCACGCCTGTCCGCCGCTGAACAATGTGCTCTACCGGTACGACCGGCGGCGGGACGTGCTGGTCAT
GACGGTGGCACGCCGCATCGAGAGCGGCACAGAGCTGCTGATCTCGTACGGTAAGACGCCGGCGATGCTGTTCCAGCGCT
TCGGCTTCCGCTGCACGTGTGGTGCCTGTTCCGGATTCAGCGAGGAGATGGCCGCCCGGTACTGGGACATGAGATGGGCG
TAGGGCAGGGACAATGTGAAAGAACACCGGGATGGATCCAGCCAGACGTAAAAAAAATAAAAAGAATAAGATAGGATACA
CGCTGTAGACTTCGGTCTGTAGATTAGTCAGCAATGATCTAGATATCGCTCCACTTTAGACTGGCTACGTCATGTTCGTA
AGACGGCCAGTGATTCGGCCGACTTTCGACATCCAAAGGCCGCAAGGGTACAGAACAGACAGCGATTAAGCGCCAGCCGG
ACGAGCAGATCGATTCCGCTTCTTCCCTTGCTAGTCGCCCGCATCAGCGCTCCTTCTCGCATACGCATCGACGCATTGGA
TCCGCCCCTTCGGAACGGCACGTCCAGATCGCCAAGACATTTGTTGCACACGCAAGACACGTCATGGTCTGTCCGATACG
CACGCTGCAGGCCGGGCTGGCGCTCGTGGCAGCGGCAGCGGCGGGTGCCAACCTGTCGCTCTCGGCCTTTCTGGTGCCGC
GGCTGCTGGAGTCGCCGCCGGCCGCGATGCTGCGCCAGTGGCGCCGCATGTACGAGTCCGGCCGGCTGGCCTCTGTGACC
ACCAGCGCGCTCTTCTCGGCCGCTCAGGTGGCCGTGTACCTGGTGCGCTGGCACGCCGCAGCAGCCGGCACCTCCTCTGG
CAGCGGCCGGCCGTCGCGGCTGCCGCTGCTGGCTGCTGGCCTCGCCACCGCCGTCATGCCCTACACGTTGACGGCTATGC
AGCGGACCAATCGGGCGCTGCTGGCGCGCTCAGCCAAGGCCGAGGCTCAGACCCAGACCACGGACGAGACCGTCTACACG
GCCCAGGAGATCGCATCGTCTCGCTACCTCGTCGACCACTGGGGCGTCCTCAACCTCGTCCGGTCTGCCCTCTGGTCGGC
TGCGGCCACAGTCGGCATCGCGGCCGTGCTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62